ID: 1196441224

View in Genome Browser
Species Human (GRCh38)
Location X:115721835-115721857
Sequence GGGAATCATGCAAGCTATTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196441224_1196441230 0 Left 1196441224 X:115721835-115721857 CCCGAATAGCTTGCATGATTCCC No data
Right 1196441230 X:115721858-115721880 ATGAGCCTTGGGAACTCACCAGG No data
1196441224_1196441232 16 Left 1196441224 X:115721835-115721857 CCCGAATAGCTTGCATGATTCCC No data
Right 1196441232 X:115721874-115721896 CACCAGGCTATTATTTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196441224 Original CRISPR GGGAATCATGCAAGCTATTC GGG (reversed) Intergenic
No off target data available for this crispr