ID: 1196456084

View in Genome Browser
Species Human (GRCh38)
Location X:115892677-115892699
Sequence GTAGAACTCCAGCACTGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196456076_1196456084 2 Left 1196456076 X:115892652-115892674 CCAGCCACCGCAAGCACCAATGG No data
Right 1196456084 X:115892677-115892699 GTAGAACTCCAGCACTGGGAAGG No data
1196456078_1196456084 -2 Left 1196456078 X:115892656-115892678 CCACCGCAAGCACCAATGGCCGT No data
Right 1196456084 X:115892677-115892699 GTAGAACTCCAGCACTGGGAAGG No data
1196456075_1196456084 8 Left 1196456075 X:115892646-115892668 CCAATGCCAGCCACCGCAAGCAC No data
Right 1196456084 X:115892677-115892699 GTAGAACTCCAGCACTGGGAAGG No data
1196456079_1196456084 -5 Left 1196456079 X:115892659-115892681 CCGCAAGCACCAATGGCCGTAGA No data
Right 1196456084 X:115892677-115892699 GTAGAACTCCAGCACTGGGAAGG No data
1196456073_1196456084 29 Left 1196456073 X:115892625-115892647 CCCAGAGATTGGAAGAACAATCC No data
Right 1196456084 X:115892677-115892699 GTAGAACTCCAGCACTGGGAAGG No data
1196456074_1196456084 28 Left 1196456074 X:115892626-115892648 CCAGAGATTGGAAGAACAATCCA No data
Right 1196456084 X:115892677-115892699 GTAGAACTCCAGCACTGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196456084 Original CRISPR GTAGAACTCCAGCACTGGGA AGG Intergenic
No off target data available for this crispr