ID: 1196457351

View in Genome Browser
Species Human (GRCh38)
Location X:115899943-115899965
Sequence GGTGGTAGAAACGGAGGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196457351_1196457364 6 Left 1196457351 X:115899943-115899965 CCACTCCCTCCGTTTCTACCACC No data
Right 1196457364 X:115899972-115899994 AGCCCGGGGACCTTCCTTCTTGG No data
1196457351_1196457355 -10 Left 1196457351 X:115899943-115899965 CCACTCCCTCCGTTTCTACCACC No data
Right 1196457355 X:115899956-115899978 TTCTACCACCACCCCCAGCCCGG No data
1196457351_1196457356 -9 Left 1196457351 X:115899943-115899965 CCACTCCCTCCGTTTCTACCACC No data
Right 1196457356 X:115899957-115899979 TCTACCACCACCCCCAGCCCGGG No data
1196457351_1196457369 21 Left 1196457351 X:115899943-115899965 CCACTCCCTCCGTTTCTACCACC No data
Right 1196457369 X:115899987-115900009 CTTCTTGGTCCCTGAAGCCAAGG No data
1196457351_1196457357 -8 Left 1196457351 X:115899943-115899965 CCACTCCCTCCGTTTCTACCACC No data
Right 1196457357 X:115899958-115899980 CTACCACCACCCCCAGCCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196457351 Original CRISPR GGTGGTAGAAACGGAGGGAG TGG (reversed) Intergenic
No off target data available for this crispr