ID: 1196458260

View in Genome Browser
Species Human (GRCh38)
Location X:115904955-115904977
Sequence AGAAGGAAGTTCCCCCGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196458260_1196458270 14 Left 1196458260 X:115904955-115904977 CCCACCCGGGGGAACTTCCTTCT No data
Right 1196458270 X:115904992-115905014 AAGTTGAGGCAAGTAACAGTTGG No data
1196458260_1196458266 0 Left 1196458260 X:115904955-115904977 CCCACCCGGGGGAACTTCCTTCT No data
Right 1196458266 X:115904978-115905000 TGATCCCCAAAGGCAAGTTGAGG No data
1196458260_1196458264 -10 Left 1196458260 X:115904955-115904977 CCCACCCGGGGGAACTTCCTTCT No data
Right 1196458264 X:115904968-115904990 ACTTCCTTCTTGATCCCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196458260 Original CRISPR AGAAGGAAGTTCCCCCGGGT GGG (reversed) Intergenic