ID: 1196464109

View in Genome Browser
Species Human (GRCh38)
Location X:115956018-115956040
Sequence ATGCCTTTCTAGAAGAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196464109_1196464111 7 Left 1196464109 X:115956018-115956040 CCTTCACTCTTCTAGAAAGGCAT No data
Right 1196464111 X:115956048-115956070 TAGGTCCTTTTTCCATTGTTTGG No data
1196464109_1196464114 30 Left 1196464109 X:115956018-115956040 CCTTCACTCTTCTAGAAAGGCAT No data
Right 1196464114 X:115956071-115956093 AGTAAAAGAAGCAATGTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196464109 Original CRISPR ATGCCTTTCTAGAAGAGTGA AGG (reversed) Intergenic
No off target data available for this crispr