ID: 1196464130

View in Genome Browser
Species Human (GRCh38)
Location X:115956286-115956308
Sequence ATGAAGAAACTGCCTAGTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196464128_1196464130 26 Left 1196464128 X:115956237-115956259 CCTATGGAGGAAACATCGGGTAT No data
Right 1196464130 X:115956286-115956308 ATGAAGAAACTGCCTAGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196464130 Original CRISPR ATGAAGAAACTGCCTAGTTA AGG Intergenic
No off target data available for this crispr