ID: 1196465844

View in Genome Browser
Species Human (GRCh38)
Location X:115970541-115970563
Sequence CTGTTTGGGCAGAGGTGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196465834_1196465844 6 Left 1196465834 X:115970512-115970534 CCAAACCTCTTCTCTTACTCATT No data
Right 1196465844 X:115970541-115970563 CTGTTTGGGCAGAGGTGGGTGGG No data
1196465835_1196465844 1 Left 1196465835 X:115970517-115970539 CCTCTTCTCTTACTCATTCCCTT No data
Right 1196465844 X:115970541-115970563 CTGTTTGGGCAGAGGTGGGTGGG No data
1196465830_1196465844 27 Left 1196465830 X:115970491-115970513 CCACCTGCTGGCCAGATACTCCC No data
Right 1196465844 X:115970541-115970563 CTGTTTGGGCAGAGGTGGGTGGG No data
1196465831_1196465844 24 Left 1196465831 X:115970494-115970516 CCTGCTGGCCAGATACTCCCAAA No data
Right 1196465844 X:115970541-115970563 CTGTTTGGGCAGAGGTGGGTGGG No data
1196465832_1196465844 16 Left 1196465832 X:115970502-115970524 CCAGATACTCCCAAACCTCTTCT No data
Right 1196465844 X:115970541-115970563 CTGTTTGGGCAGAGGTGGGTGGG No data
1196465833_1196465844 7 Left 1196465833 X:115970511-115970533 CCCAAACCTCTTCTCTTACTCAT No data
Right 1196465844 X:115970541-115970563 CTGTTTGGGCAGAGGTGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196465844 Original CRISPR CTGTTTGGGCAGAGGTGGGT GGG Intergenic
No off target data available for this crispr