ID: 1196467773

View in Genome Browser
Species Human (GRCh38)
Location X:115990883-115990905
Sequence CTATTTTACCATGGCTAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196467773_1196467778 -1 Left 1196467773 X:115990883-115990905 CCAGCTTAGCCATGGTAAAATAG No data
Right 1196467778 X:115990905-115990927 GGGCACTGGACAAAGTTACGAGG No data
1196467773_1196467779 12 Left 1196467773 X:115990883-115990905 CCAGCTTAGCCATGGTAAAATAG No data
Right 1196467779 X:115990918-115990940 AGTTACGAGGCTCCCATTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196467773 Original CRISPR CTATTTTACCATGGCTAAGC TGG (reversed) Intergenic
No off target data available for this crispr