ID: 1196475189

View in Genome Browser
Species Human (GRCh38)
Location X:116076259-116076281
Sequence AATTCTATGCAGAATGTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196475189_1196475192 4 Left 1196475189 X:116076259-116076281 CCAGTGACATTCTGCATAGAATT No data
Right 1196475192 X:116076286-116076308 AAAAAATTCTAAAATACATGGGG No data
1196475189_1196475190 2 Left 1196475189 X:116076259-116076281 CCAGTGACATTCTGCATAGAATT No data
Right 1196475190 X:116076284-116076306 AAAAAAAATTCTAAAATACATGG No data
1196475189_1196475191 3 Left 1196475189 X:116076259-116076281 CCAGTGACATTCTGCATAGAATT No data
Right 1196475191 X:116076285-116076307 AAAAAAATTCTAAAATACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196475189 Original CRISPR AATTCTATGCAGAATGTCAC TGG (reversed) Intergenic