ID: 1196475482

View in Genome Browser
Species Human (GRCh38)
Location X:116079671-116079693
Sequence CTGTATTTTGGCTGGTGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196475479_1196475482 -10 Left 1196475479 X:116079658-116079680 CCTGCTGGTGAGACTGTATTTTG No data
Right 1196475482 X:116079671-116079693 CTGTATTTTGGCTGGTGATGTGG No data
1196475476_1196475482 27 Left 1196475476 X:116079621-116079643 CCAGGCTAGGATGGACTTAAGCC No data
Right 1196475482 X:116079671-116079693 CTGTATTTTGGCTGGTGATGTGG No data
1196475477_1196475482 6 Left 1196475477 X:116079642-116079664 CCATCAACAGAGATAACCTGCTG No data
Right 1196475482 X:116079671-116079693 CTGTATTTTGGCTGGTGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196475482 Original CRISPR CTGTATTTTGGCTGGTGATG TGG Intergenic
No off target data available for this crispr