ID: 1196483781

View in Genome Browser
Species Human (GRCh38)
Location X:116180920-116180942
Sequence CTTTATTAGCAGAGTGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 8564
Summary {0: 5, 1: 179, 2: 2034, 3: 3746, 4: 2600}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196483777_1196483781 27 Left 1196483777 X:116180870-116180892 CCATTAAACCTATCTTCCCTGTC No data
Right 1196483781 X:116180920-116180942 CTTTATTAGCAGAGTGAAAATGG 0: 5
1: 179
2: 2034
3: 3746
4: 2600
1196483778_1196483781 19 Left 1196483778 X:116180878-116180900 CCTATCTTCCCTGTCTTTATTGT No data
Right 1196483781 X:116180920-116180942 CTTTATTAGCAGAGTGAAAATGG 0: 5
1: 179
2: 2034
3: 3746
4: 2600
1196483779_1196483781 11 Left 1196483779 X:116180886-116180908 CCCTGTCTTTATTGTTATAATAT No data
Right 1196483781 X:116180920-116180942 CTTTATTAGCAGAGTGAAAATGG 0: 5
1: 179
2: 2034
3: 3746
4: 2600
1196483780_1196483781 10 Left 1196483780 X:116180887-116180909 CCTGTCTTTATTGTTATAATATT No data
Right 1196483781 X:116180920-116180942 CTTTATTAGCAGAGTGAAAATGG 0: 5
1: 179
2: 2034
3: 3746
4: 2600

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196483781 Original CRISPR CTTTATTAGCAGAGTGAAAA TGG Intergenic
Too many off-targets to display for this crispr