ID: 1196483946

View in Genome Browser
Species Human (GRCh38)
Location X:116182108-116182130
Sequence GGGCTTGGGAAGCTGAGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196483938_1196483946 18 Left 1196483938 X:116182067-116182089 CCATCTCCGTCATAGCTGGAGTA No data
Right 1196483946 X:116182108-116182130 GGGCTTGGGAAGCTGAGCACAGG No data
1196483939_1196483946 12 Left 1196483939 X:116182073-116182095 CCGTCATAGCTGGAGTATGCAAT No data
Right 1196483946 X:116182108-116182130 GGGCTTGGGAAGCTGAGCACAGG No data
1196483936_1196483946 22 Left 1196483936 X:116182063-116182085 CCTACCATCTCCGTCATAGCTGG No data
Right 1196483946 X:116182108-116182130 GGGCTTGGGAAGCTGAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196483946 Original CRISPR GGGCTTGGGAAGCTGAGCAC AGG Intergenic
No off target data available for this crispr