ID: 1196485704

View in Genome Browser
Species Human (GRCh38)
Location X:116204163-116204185
Sequence AGGGAGAGTGCAGCAACTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196485704_1196485715 26 Left 1196485704 X:116204163-116204185 CCCCCAGTTGCTGCACTCTCCCT No data
Right 1196485715 X:116204212-116204234 CTGCCACATGGCCACTTCTAAGG No data
1196485704_1196485713 14 Left 1196485704 X:116204163-116204185 CCCCCAGTTGCTGCACTCTCCCT No data
Right 1196485713 X:116204200-116204222 GATTCTCTCTTCCTGCCACATGG No data
1196485704_1196485716 27 Left 1196485704 X:116204163-116204185 CCCCCAGTTGCTGCACTCTCCCT No data
Right 1196485716 X:116204213-116204235 TGCCACATGGCCACTTCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196485704 Original CRISPR AGGGAGAGTGCAGCAACTGG GGG (reversed) Intergenic
No off target data available for this crispr