ID: 1196487181

View in Genome Browser
Species Human (GRCh38)
Location X:116225726-116225748
Sequence TTTTGCCAACATTTGTTATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196487181_1196487183 -9 Left 1196487181 X:116225726-116225748 CCTCATAACAAATGTTGGCAAAA No data
Right 1196487183 X:116225740-116225762 TTGGCAAAAATGTGGAGAAATGG No data
1196487181_1196487184 14 Left 1196487181 X:116225726-116225748 CCTCATAACAAATGTTGGCAAAA No data
Right 1196487184 X:116225763-116225785 AAATGCCTGTACACTGCTTGTGG No data
1196487181_1196487186 19 Left 1196487181 X:116225726-116225748 CCTCATAACAAATGTTGGCAAAA No data
Right 1196487186 X:116225768-116225790 CCTGTACACTGCTTGTGGAGAGG No data
1196487181_1196487187 27 Left 1196487181 X:116225726-116225748 CCTCATAACAAATGTTGGCAAAA No data
Right 1196487187 X:116225776-116225798 CTGCTTGTGGAGAGGTACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196487181 Original CRISPR TTTTGCCAACATTTGTTATG AGG (reversed) Intergenic
No off target data available for this crispr