ID: 1196487187

View in Genome Browser
Species Human (GRCh38)
Location X:116225776-116225798
Sequence CTGCTTGTGGAGAGGTACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196487181_1196487187 27 Left 1196487181 X:116225726-116225748 CCTCATAACAAATGTTGGCAAAA No data
Right 1196487187 X:116225776-116225798 CTGCTTGTGGAGAGGTACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196487187 Original CRISPR CTGCTTGTGGAGAGGTACAT TGG Intergenic
No off target data available for this crispr