ID: 1196494674

View in Genome Browser
Species Human (GRCh38)
Location X:116310626-116310648
Sequence TCTTCTCTCTATAAGGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196494674_1196494676 -7 Left 1196494674 X:116310626-116310648 CCTTGCACCTTATAGAGAGAAGA No data
Right 1196494676 X:116310642-116310664 GAGAAGATTGTTTCTTTAGATGG No data
1196494674_1196494677 -1 Left 1196494674 X:116310626-116310648 CCTTGCACCTTATAGAGAGAAGA No data
Right 1196494677 X:116310648-116310670 ATTGTTTCTTTAGATGGAAGTGG No data
1196494674_1196494678 0 Left 1196494674 X:116310626-116310648 CCTTGCACCTTATAGAGAGAAGA No data
Right 1196494678 X:116310649-116310671 TTGTTTCTTTAGATGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196494674 Original CRISPR TCTTCTCTCTATAAGGTGCA AGG (reversed) Intergenic
No off target data available for this crispr