ID: 1196495035

View in Genome Browser
Species Human (GRCh38)
Location X:116314718-116314740
Sequence GTAGTTTTAAAGAGCTCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196495035_1196495042 21 Left 1196495035 X:116314718-116314740 CCTGTGGAGCTCTTTAAAACTAC No data
Right 1196495042 X:116314762-116314784 TCCACTTAAATTAGAATACTGGG No data
1196495035_1196495041 20 Left 1196495035 X:116314718-116314740 CCTGTGGAGCTCTTTAAAACTAC No data
Right 1196495041 X:116314761-116314783 GTCCACTTAAATTAGAATACTGG No data
1196495035_1196495046 28 Left 1196495035 X:116314718-116314740 CCTGTGGAGCTCTTTAAAACTAC No data
Right 1196495046 X:116314769-116314791 AAATTAGAATACTGGGGATAGGG No data
1196495035_1196495044 22 Left 1196495035 X:116314718-116314740 CCTGTGGAGCTCTTTAAAACTAC No data
Right 1196495044 X:116314763-116314785 CCACTTAAATTAGAATACTGGGG No data
1196495035_1196495045 27 Left 1196495035 X:116314718-116314740 CCTGTGGAGCTCTTTAAAACTAC No data
Right 1196495045 X:116314768-116314790 TAAATTAGAATACTGGGGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196495035 Original CRISPR GTAGTTTTAAAGAGCTCCAC AGG (reversed) Intergenic
No off target data available for this crispr