ID: 1196495344

View in Genome Browser
Species Human (GRCh38)
Location X:116318022-116318044
Sequence AAGAACAAGGAGCAGTAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196495335_1196495344 29 Left 1196495335 X:116317970-116317992 CCAAGTCCTGGCAGGATCCATTA No data
Right 1196495344 X:116318022-116318044 AAGAACAAGGAGCAGTAGCCAGG No data
1196495337_1196495344 12 Left 1196495337 X:116317987-116318009 CCATTACCTGTAAGCTAAAGAGT No data
Right 1196495344 X:116318022-116318044 AAGAACAAGGAGCAGTAGCCAGG No data
1196495338_1196495344 6 Left 1196495338 X:116317993-116318015 CCTGTAAGCTAAAGAGTTCTTGG No data
Right 1196495344 X:116318022-116318044 AAGAACAAGGAGCAGTAGCCAGG No data
1196495336_1196495344 23 Left 1196495336 X:116317976-116317998 CCTGGCAGGATCCATTACCTGTA No data
Right 1196495344 X:116318022-116318044 AAGAACAAGGAGCAGTAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196495344 Original CRISPR AAGAACAAGGAGCAGTAGCC AGG Intergenic
No off target data available for this crispr