ID: 1196495797 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:116324036-116324058 |
Sequence | CTAGGGTTGAGAATTACTAC GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1196495797_1196495801 | 2 | Left | 1196495797 | X:116324036-116324058 | CCCGTAGTAATTCTCAACCCTAG | No data | ||
Right | 1196495801 | X:116324061-116324083 | GCACCTTAGAATTACCTGAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1196495797 | Original CRISPR | CTAGGGTTGAGAATTACTAC GGG (reversed) | Intergenic | ||