ID: 1196495797

View in Genome Browser
Species Human (GRCh38)
Location X:116324036-116324058
Sequence CTAGGGTTGAGAATTACTAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196495797_1196495801 2 Left 1196495797 X:116324036-116324058 CCCGTAGTAATTCTCAACCCTAG No data
Right 1196495801 X:116324061-116324083 GCACCTTAGAATTACCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196495797 Original CRISPR CTAGGGTTGAGAATTACTAC GGG (reversed) Intergenic