ID: 1196504768

View in Genome Browser
Species Human (GRCh38)
Location X:116428398-116428420
Sequence TCTTATATGAACATAGTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196504768_1196504769 14 Left 1196504768 X:116428398-116428420 CCATGAACTATGTTCATATAAGA No data
Right 1196504769 X:116428435-116428457 GTGTATTCTGACTGCTCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196504768 Original CRISPR TCTTATATGAACATAGTTCA TGG (reversed) Intergenic
No off target data available for this crispr