ID: 1196509552

View in Genome Browser
Species Human (GRCh38)
Location X:116491707-116491729
Sequence CACCCACAATTTTTTAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196509552_1196509554 7 Left 1196509552 X:116491707-116491729 CCTGTCTTAAAAAATTGTGGGTG No data
Right 1196509554 X:116491737-116491759 GGTGTGTGTATATATATATATGG No data
1196509552_1196509555 8 Left 1196509552 X:116491707-116491729 CCTGTCTTAAAAAATTGTGGGTG No data
Right 1196509555 X:116491738-116491760 GTGTGTGTATATATATATATGGG 0: 28
1: 104
2: 325
3: 971
4: 3437

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196509552 Original CRISPR CACCCACAATTTTTTAAGAC AGG (reversed) Intergenic
No off target data available for this crispr