ID: 1196512097 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:116523840-116523862 |
Sequence | CTGTTTTTCTCAAGCAAAAA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1196512093_1196512097 | 13 | Left | 1196512093 | X:116523804-116523826 | CCTAAGCTCAGGACAATGTCATC | No data | ||
Right | 1196512097 | X:116523840-116523862 | CTGTTTTTCTCAAGCAAAAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1196512097 | Original CRISPR | CTGTTTTTCTCAAGCAAAAA GGG | Intergenic | ||
No off target data available for this crispr |