ID: 1196512097

View in Genome Browser
Species Human (GRCh38)
Location X:116523840-116523862
Sequence CTGTTTTTCTCAAGCAAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196512093_1196512097 13 Left 1196512093 X:116523804-116523826 CCTAAGCTCAGGACAATGTCATC No data
Right 1196512097 X:116523840-116523862 CTGTTTTTCTCAAGCAAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196512097 Original CRISPR CTGTTTTTCTCAAGCAAAAA GGG Intergenic
No off target data available for this crispr