ID: 1196512190

View in Genome Browser
Species Human (GRCh38)
Location X:116524591-116524613
Sequence AGGGAGAGCACAATGATTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196512190_1196512197 26 Left 1196512190 X:116524591-116524613 CCTCCAATCATTGTGCTCTCCCT No data
Right 1196512197 X:116524640-116524662 GCACCTGCAGCCACTGCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196512190 Original CRISPR AGGGAGAGCACAATGATTGG AGG (reversed) Intergenic
No off target data available for this crispr