ID: 1196518371

View in Genome Browser
Species Human (GRCh38)
Location X:116640857-116640879
Sequence GAAATGCTGAAACACTTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196518371_1196518373 -2 Left 1196518371 X:116640857-116640879 CCAGGTAAGTGTTTCAGCATTTC No data
Right 1196518373 X:116640878-116640900 TCACTTGGCTGTATATGCGACGG No data
1196518371_1196518375 19 Left 1196518371 X:116640857-116640879 CCAGGTAAGTGTTTCAGCATTTC No data
Right 1196518375 X:116640899-116640921 GGCATACATAAATATGGATTTGG No data
1196518371_1196518374 13 Left 1196518371 X:116640857-116640879 CCAGGTAAGTGTTTCAGCATTTC No data
Right 1196518374 X:116640893-116640915 TGCGACGGCATACATAAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196518371 Original CRISPR GAAATGCTGAAACACTTACC TGG (reversed) Intergenic
No off target data available for this crispr