ID: 1196519893

View in Genome Browser
Species Human (GRCh38)
Location X:116661069-116661091
Sequence CGTGCCCGCGGCTGTCGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196519893_1196519905 30 Left 1196519893 X:116661069-116661091 CCACCTCGACAGCCGCGGGCACG No data
Right 1196519905 X:116661122-116661144 CCTTTTCCAGCCCGGGTGCCTGG No data
1196519893_1196519901 23 Left 1196519893 X:116661069-116661091 CCACCTCGACAGCCGCGGGCACG No data
Right 1196519901 X:116661115-116661137 ACCCTCTCCTTTTCCAGCCCGGG No data
1196519893_1196519900 22 Left 1196519893 X:116661069-116661091 CCACCTCGACAGCCGCGGGCACG No data
Right 1196519900 X:116661114-116661136 CACCCTCTCCTTTTCCAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196519893 Original CRISPR CGTGCCCGCGGCTGTCGAGG TGG (reversed) Intergenic