ID: 1196523811

View in Genome Browser
Species Human (GRCh38)
Location X:116707539-116707561
Sequence AAGGGAGACCAGTGCCTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196523811_1196523815 -8 Left 1196523811 X:116707539-116707561 CCTTCAAGGCACTGGTCTCCCTT No data
Right 1196523815 X:116707554-116707576 TCTCCCTTTTGGCTTAGGGCAGG No data
1196523811_1196523819 24 Left 1196523811 X:116707539-116707561 CCTTCAAGGCACTGGTCTCCCTT No data
Right 1196523819 X:116707586-116707608 ACTGTCCAAGATTCTCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196523811 Original CRISPR AAGGGAGACCAGTGCCTTGA AGG (reversed) Intergenic
No off target data available for this crispr