ID: 1196523815

View in Genome Browser
Species Human (GRCh38)
Location X:116707554-116707576
Sequence TCTCCCTTTTGGCTTAGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196523810_1196523815 -7 Left 1196523810 X:116707538-116707560 CCCTTCAAGGCACTGGTCTCCCT No data
Right 1196523815 X:116707554-116707576 TCTCCCTTTTGGCTTAGGGCAGG No data
1196523807_1196523815 9 Left 1196523807 X:116707522-116707544 CCTGGTCTGGGATTCACCCTTCA No data
Right 1196523815 X:116707554-116707576 TCTCCCTTTTGGCTTAGGGCAGG No data
1196523811_1196523815 -8 Left 1196523811 X:116707539-116707561 CCTTCAAGGCACTGGTCTCCCTT No data
Right 1196523815 X:116707554-116707576 TCTCCCTTTTGGCTTAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196523815 Original CRISPR TCTCCCTTTTGGCTTAGGGC AGG Intergenic
No off target data available for this crispr