ID: 1196523819

View in Genome Browser
Species Human (GRCh38)
Location X:116707586-116707608
Sequence ACTGTCCAAGATTCTCATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196523816_1196523819 6 Left 1196523816 X:116707557-116707579 CCCTTTTGGCTTAGGGCAGGTCC No data
Right 1196523819 X:116707586-116707608 ACTGTCCAAGATTCTCATCCTGG No data
1196523810_1196523819 25 Left 1196523810 X:116707538-116707560 CCCTTCAAGGCACTGGTCTCCCT No data
Right 1196523819 X:116707586-116707608 ACTGTCCAAGATTCTCATCCTGG No data
1196523817_1196523819 5 Left 1196523817 X:116707558-116707580 CCTTTTGGCTTAGGGCAGGTCCA No data
Right 1196523819 X:116707586-116707608 ACTGTCCAAGATTCTCATCCTGG No data
1196523811_1196523819 24 Left 1196523811 X:116707539-116707561 CCTTCAAGGCACTGGTCTCCCTT No data
Right 1196523819 X:116707586-116707608 ACTGTCCAAGATTCTCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196523819 Original CRISPR ACTGTCCAAGATTCTCATCC TGG Intergenic
No off target data available for this crispr