ID: 1196527190

View in Genome Browser
Species Human (GRCh38)
Location X:116740472-116740494
Sequence AGCTGGGTATAGAGGGAAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196527179_1196527190 28 Left 1196527179 X:116740421-116740443 CCACTCTGCTTCCTTTGGTATTT No data
Right 1196527190 X:116740472-116740494 AGCTGGGTATAGAGGGAAAACGG No data
1196527182_1196527190 17 Left 1196527182 X:116740432-116740454 CCTTTGGTATTTGGGAAAGCAGA No data
Right 1196527190 X:116740472-116740494 AGCTGGGTATAGAGGGAAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196527190 Original CRISPR AGCTGGGTATAGAGGGAAAA CGG Intergenic
No off target data available for this crispr