ID: 1196527344 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:116741524-116741546 |
| Sequence | CTGGGTATAGAGAGGGACAA CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1196527344_1196527355 | 30 | Left | 1196527344 | X:116741524-116741546 | CCGTTGTCCCTCTCTATACCCAG | No data | ||
| Right | 1196527355 | X:116741577-116741599 | AAATACCAGAGGAAGCAGAGTGG | 0: 57 1: 121 2: 79 3: 63 4: 394 |
||||
| 1196527344_1196527352 | 19 | Left | 1196527344 | X:116741524-116741546 | CCGTTGTCCCTCTCTATACCCAG | No data | ||
| Right | 1196527352 | X:116741566-116741588 | TCTGCTTTCCCAAATACCAGAGG | 0: 59 1: 30 2: 19 3: 111 4: 255 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1196527344 | Original CRISPR | CTGGGTATAGAGAGGGACAA CGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||