ID: 1196527344

View in Genome Browser
Species Human (GRCh38)
Location X:116741524-116741546
Sequence CTGGGTATAGAGAGGGACAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196527344_1196527355 30 Left 1196527344 X:116741524-116741546 CCGTTGTCCCTCTCTATACCCAG No data
Right 1196527355 X:116741577-116741599 AAATACCAGAGGAAGCAGAGTGG 0: 57
1: 121
2: 79
3: 63
4: 394
1196527344_1196527352 19 Left 1196527344 X:116741524-116741546 CCGTTGTCCCTCTCTATACCCAG No data
Right 1196527352 X:116741566-116741588 TCTGCTTTCCCAAATACCAGAGG 0: 59
1: 30
2: 19
3: 111
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196527344 Original CRISPR CTGGGTATAGAGAGGGACAA CGG (reversed) Intergenic
No off target data available for this crispr