ID: 1196527352

View in Genome Browser
Species Human (GRCh38)
Location X:116741566-116741588
Sequence TCTGCTTTCCCAAATACCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 474
Summary {0: 59, 1: 30, 2: 19, 3: 111, 4: 255}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196527345_1196527352 12 Left 1196527345 X:116741531-116741553 CCCTCTCTATACCCAGCTGTACC No data
Right 1196527352 X:116741566-116741588 TCTGCTTTCCCAAATACCAGAGG 0: 59
1: 30
2: 19
3: 111
4: 255
1196527347_1196527352 1 Left 1196527347 X:116741542-116741564 CCCAGCTGTACCTAACCCTTATA 0: 39
1: 34
2: 14
3: 12
4: 96
Right 1196527352 X:116741566-116741588 TCTGCTTTCCCAAATACCAGAGG 0: 59
1: 30
2: 19
3: 111
4: 255
1196527346_1196527352 11 Left 1196527346 X:116741532-116741554 CCTCTCTATACCCAGCTGTACCT No data
Right 1196527352 X:116741566-116741588 TCTGCTTTCCCAAATACCAGAGG 0: 59
1: 30
2: 19
3: 111
4: 255
1196527348_1196527352 0 Left 1196527348 X:116741543-116741565 CCAGCTGTACCTAACCCTTATAC 0: 38
1: 33
2: 42
3: 112
4: 192
Right 1196527352 X:116741566-116741588 TCTGCTTTCCCAAATACCAGAGG 0: 59
1: 30
2: 19
3: 111
4: 255
1196527349_1196527352 -9 Left 1196527349 X:116741552-116741574 CCTAACCCTTATACTCTGCTTTC 0: 40
1: 37
2: 64
3: 877
4: 1690
Right 1196527352 X:116741566-116741588 TCTGCTTTCCCAAATACCAGAGG 0: 59
1: 30
2: 19
3: 111
4: 255
1196527344_1196527352 19 Left 1196527344 X:116741524-116741546 CCGTTGTCCCTCTCTATACCCAG No data
Right 1196527352 X:116741566-116741588 TCTGCTTTCCCAAATACCAGAGG 0: 59
1: 30
2: 19
3: 111
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196527352 Original CRISPR TCTGCTTTCCCAAATACCAG AGG Intergenic
905950547 1:41946990-41947012 TGTGCTTTCCCAAATACCAGAGG + Intronic
906507084 1:46388308-46388330 TCTGCTTTCCCAAATACCAGAGG - Intergenic
906583588 1:46956353-46956375 TCTGCTTTCCCAAATACCAGAGG + Intergenic
907505431 1:54914758-54914780 TCTGCTTTCCCAAATACCAGAGG - Intergenic
907602379 1:55784287-55784309 TCTGCTTTCCCAAATACCAGAGG - Intergenic
907842566 1:58171520-58171542 CCTGCTCTCTCAAATACCAGAGG + Intronic
907845410 1:58201414-58201436 TCTGCTTTGCTGAATACCAAAGG + Intronic
908158652 1:61384234-61384256 TCTGCTTTGACATATACCTGGGG + Intronic
908300629 1:62758149-62758171 CCTGCTCTCTCAAATACCAGAGG + Intergenic
910070844 1:83212095-83212117 TCTTCCTTCCTAAATCCCAGTGG + Intergenic
910397236 1:86805269-86805291 CCTGCTCTCTCAAATACCAGAGG - Intergenic
910506844 1:87959171-87959193 TCTGTTTTCACAAAAACCAGAGG - Intergenic
910545619 1:88413635-88413657 TCTGCTTTCCAAAATAACTGAGG + Intergenic
910591201 1:88929346-88929368 TCTGCTTTCCCAAATGCCAGAGG + Intergenic
911129565 1:94374929-94374951 TCTGCTCTCTCAAATACCAGAGG - Intergenic
911426977 1:97728866-97728888 TCTTCTTTGCCAAATATCTGAGG - Intronic
911634271 1:100216118-100216140 TCTGCTTTTCCAAATAGTTGAGG + Exonic
911751618 1:101502778-101502800 CCTGCTCTCTCAAATACCAGAGG + Intergenic
912021512 1:105112909-105112931 CCTGCTCTCTCAAATACCAGAGG + Intergenic
912463764 1:109855177-109855199 TCTGCTTTCCCAAATACCAGAGG - Intergenic
912474950 1:109929201-109929223 CCTGCTTTCCCACAAACCACAGG - Exonic
913382828 1:118229426-118229448 CCAGCTATCTCAAATACCAGAGG + Intergenic
913468859 1:119170836-119170858 TCTGCTTTCCCAAATACCAGAGG - Intergenic
913469744 1:119176189-119176211 CCTGCTCCCTCAAATACCAGAGG + Intergenic
915260789 1:154675379-154675401 CCTGCTCTCTCAAATACCAGAGG + Intergenic
915401301 1:155623907-155623929 TCTACTCTCCCAGATACCAGAGG - Intergenic
915645830 1:157271481-157271503 TTTGCTTTCCTAAATATGAGAGG + Intergenic
916083885 1:161254262-161254284 CCTGCTCTCTCAAATGCCAGAGG + Intergenic
916114657 1:161476455-161476477 CCTGCTCTCTCAAATACCAGAGG + Intergenic
917086336 1:171308730-171308752 CCTCCTCTCTCAAATACCAGAGG + Intergenic
917280102 1:173371747-173371769 CCTGCTTTCTCAAATACCAGAGG + Intergenic
917441037 1:175069167-175069189 TCAGCTTTTCCAAGAACCAGTGG - Intronic
919558919 1:199094414-199094436 TCTGCTCTATCAAATACCAGAGG + Intergenic
920425982 1:205875550-205875572 TCTGCTTTCACAATTTCCTGGGG - Intergenic
920736095 1:208534199-208534221 TCTGCTTTCCCTAAGAGCAGAGG + Intergenic
921092578 1:211857658-211857680 TCTGCTCTCCCAAATACCAGAGG - Intergenic
921475023 1:215596357-215596379 TCTTCTTTCCCAAATTCCAAAGG - Intronic
921961437 1:221039086-221039108 TCTGCTTTTCCAAATACCAAAGG + Intergenic
922644295 1:227270378-227270400 TCTGCTTTCAGAAATAAAAGTGG - Intronic
922684524 1:227628974-227628996 TTTGCTTTTCCAAATACCAAAGG - Intronic
923764237 1:236878326-236878348 TATGATTTCCCACAAACCAGTGG + Intronic
1063321486 10:5056349-5056371 CCTGCTCTCTCAAATACTAGAGG - Intronic
1064617873 10:17181243-17181265 TCTGCTTTCCAAACCTCCAGTGG - Intronic
1065082642 10:22142681-22142703 CCTGCTCTCTCAAATACCAGAGG + Intergenic
1065199407 10:23299092-23299114 TCTGCTTTCCCAAATACCAGAGG - Intronic
1065993665 10:31036414-31036436 TCTGATTTCCGAGTTACCAGAGG - Intergenic
1066614359 10:37280762-37280784 CCTGCTCTCTCAAATACCAAAGG - Intronic
1068500532 10:57836564-57836586 CCTGCTCTCTCAAATACCAGAGG + Intergenic
1068791657 10:61036676-61036698 TCTGCTTTCCTAAATACCAGAGG - Intergenic
1069137122 10:64780929-64780951 CCTGCTCTCCCAAATACCAGAGG - Intergenic
1069160875 10:65091152-65091174 TCTGTTTTCCCAGATAAAAGGGG - Intergenic
1072371440 10:94769489-94769511 CCTGCTCTGTCAAATACCAGAGG - Intronic
1072377933 10:94837090-94837112 TCTGCTTTCCCAAATACCAGAGG - Intronic
1072471760 10:95719942-95719964 TCTGCTTTCCCAAATACCAGAGG - Intronic
1073048910 10:100655564-100655586 GCTGCCTTCCCAATTCCCAGTGG + Intergenic
1073104243 10:101023223-101023245 TCTGCTCTCCCAGATCCCAGTGG - Intronic
1073755158 10:106573319-106573341 TCTGCCTTTCCAAATACTATGGG - Intergenic
1073965738 10:108987521-108987543 TGTGCTTTGTCAAGTACCAGGGG - Intergenic
1073970974 10:109045153-109045175 CTTGCTTTCTCAAATACCAGAGG + Intergenic
1075146545 10:119887364-119887386 CCTGCTCTTTCAAATACCAGAGG + Intronic
1078686225 11:13534707-13534729 TTTTCTTTCCCATATCCCAGTGG - Intergenic
1079394402 11:20049519-20049541 TCTGCTTGCACAATTACAAGGGG - Intronic
1079601153 11:22314655-22314677 TCTGCTTTCCCAAATACCAGAGG - Intergenic
1079735499 11:23992818-23992840 TCCACTTTCCCAAATCCCAATGG + Intergenic
1079811444 11:25003428-25003450 CCTGCTCTCTCAAATACCAGAGG - Intronic
1081421654 11:42878849-42878871 CCTGCTCTCTCAAATACCAGAGG + Intergenic
1081548875 11:44094254-44094276 TCTGCTTCCCCACATCCAAGGGG - Intergenic
1082983396 11:59144825-59144847 TTTGCTTCCTCAAATACGAGCGG + Exonic
1084211238 11:67623899-67623921 CCTGCTCTCTCAAATACCAGAGG + Intergenic
1084708144 11:70827912-70827934 TCTGCTCTCCCTAAAGCCAGAGG - Intronic
1085220967 11:74873384-74873406 TTTGCTAACCCAAATACCTGAGG + Intronic
1085601615 11:77860813-77860835 TCTGCTTTCCCAAATACCAGAGG - Intronic
1086317617 11:85610373-85610395 CCTGCTCTCTCAAATATCAGAGG + Intronic
1086441830 11:86836102-86836124 TCTGCTTTCTCAAATACCAGAGG - Intronic
1086443349 11:86849751-86849773 GCTGCTCTCTCAGATACCAGAGG + Intronic
1087075210 11:94122061-94122083 CCTGCTCTCTCAAATACCAGAGG + Intergenic
1087424246 11:97968711-97968733 TTTGCTAACCCAAATACCTGAGG - Intergenic
1088492766 11:110403263-110403285 CCTGCTCTCTCAAATACCAGAGG + Intergenic
1088777600 11:113100588-113100610 TCAGCTATCCCAAACTCCAGGGG - Intronic
1088930664 11:114348048-114348070 TCTACTCTCCCAGATACCAGAGG - Intergenic
1089164963 11:116468734-116468756 CCTGCCTTCCTAAAAACCAGAGG + Intergenic
1089233883 11:117006144-117006166 CCTGCTGTGCCAAAGACCAGGGG - Intronic
1089356011 11:117854341-117854363 TGTGCTTTCCCTATTCCCAGGGG - Intronic
1092294227 12:7185395-7185417 TTTGCTTTCACAAATACCAGAGG + Intergenic
1092469287 12:8763972-8763994 TCTGCTTTCCTAAATGCCAGAGG - Intronic
1092472542 12:8792149-8792171 CCTGCTCTCTCAAACACCAGAGG + Intergenic
1092821682 12:12358768-12358790 CCTCCTTCCCCAGATACCAGAGG - Intronic
1093345471 12:18035159-18035181 CCTGCTCTCTCATATACCAGAGG + Intergenic
1093798931 12:23348005-23348027 GCTACTTTCCCAAATGCCAAGGG + Intergenic
1094806621 12:34100425-34100447 TCTGCTTTCTCAAATACCAGAGG + Intergenic
1095093958 12:38134792-38134814 TCTGCTTTCCTAAATATTAAAGG - Intergenic
1095125466 12:38471891-38471913 TCTGCTTTCCCAAATACCAGAGG + Intergenic
1095230997 12:39739805-39739827 AATGCCTTCCCAAATTCCAGAGG - Intronic
1095284086 12:40388441-40388463 CCTGCTTTCCCAAATACCAGGGG + Intergenic
1096351915 12:50907757-50907779 TCTGCTTTCCCAAATACCAGAGG - Intergenic
1097187630 12:57204223-57204245 TCTTCTCCCCTAAATACCAGAGG + Intronic
1100092364 12:90986484-90986506 TCTGCGCTCTCAAATACCAGAGG + Intronic
1100098530 12:91074311-91074333 TCTGCTCTCCCAAGAAGCAGTGG - Intergenic
1100210024 12:92390478-92390500 CCTGCTCTCTCAAATAACAGAGG + Intergenic
1100787308 12:98092042-98092064 TCTGCTTACCACAATACAAGTGG - Intergenic
1101244179 12:102869712-102869734 TTTGCTTTCTCAGTTACCAGTGG + Intronic
1103629799 12:122250993-122251015 TCTCCTTTCCCAAAGATCTGGGG + Exonic
1103803262 12:123553346-123553368 TCTGCTTTCCCAAATACCAGAGG + Intergenic
1104632589 12:130416432-130416454 TCAGCTTTGTCAAATATCAGAGG - Intronic
1105761743 13:23521709-23521731 TGTGCTTTCCTAAAAGCCAGAGG - Intergenic
1105834177 13:24193706-24193728 TATGCTTTAGCAAATATCAGAGG + Intronic
1106162931 13:27216594-27216616 ATTGCTCTCTCAAATACCAGAGG + Intergenic
1106524162 13:30525377-30525399 TCTGATGTCACAAAAACCAGTGG - Intronic
1106935701 13:34716407-34716429 TCTGCTTTTCCAAATAGCGTAGG + Intergenic
1107431926 13:40348057-40348079 GCTGCTTTCCCAAAGAACTGAGG + Intergenic
1107655223 13:42585987-42586009 GCTTCTTTCCCACATCCCAGGGG - Intronic
1108104042 13:46989429-46989451 TCTGCTTTCCAAATTATCATAGG + Intergenic
1108848832 13:54704119-54704141 CCTGCTCTCTCAAATACCAGAGG + Intergenic
1108876833 13:55058524-55058546 TCTGCTTTCCCAAATACCAGAGG + Intergenic
1109424677 13:62154134-62154156 CCTGCTCTCTGAAATACCAGAGG + Intergenic
1109704706 13:66074436-66074458 TCTCCTTTCCCCATTGCCAGAGG - Intergenic
1110556364 13:76863961-76863983 TCTATTTTCCCAAAAACCATGGG - Intergenic
1111372751 13:87337368-87337390 CCTGCTTTCTCAAATACCAGAGG + Intergenic
1111618409 13:90691595-90691617 TCTGCTTGCCCAGAAAGCAGAGG - Intergenic
1112321417 13:98411309-98411331 TGTGCTTTCCCAGAATCCAGGGG - Intronic
1112519359 13:100082151-100082173 CCTGCTCTCTCAAATACCAGAGG + Intergenic
1112538611 13:100284670-100284692 CCTGCTCTCTCAAGTACCAGAGG + Intronic
1113203703 13:107893435-107893457 CCTGCTCTCTCAAATACCAGAGG - Intergenic
1113388629 13:109874154-109874176 CCTGGTTTCCCCAACACCAGGGG + Intergenic
1113551269 13:111194906-111194928 CCTGCTCTCTCAAATACCAGAGG - Intronic
1114384468 14:22241167-22241189 TCTGCTTTCCCAAATACCAGAGG + Intergenic
1115285231 14:31708064-31708086 CCTGCTCTCTCAAATACCAGAGG - Intronic
1115962912 14:38855726-38855748 TTTGCTTTCCCAAGGACCAGGGG + Intergenic
1116025910 14:39514395-39514417 TCTGCTCTCACAAATATCTGTGG - Intergenic
1116414120 14:44660015-44660037 TATGGTTACCCAAATGCCAGAGG + Intergenic
1117672592 14:58123587-58123609 TCTGCTTTCCCAAATACCAGAGG + Intronic
1118460585 14:65983585-65983607 ACCGCTTTCCAATATACCAGTGG - Intronic
1118603320 14:67485679-67485701 GCTGCTTTCCCAACCCCCAGAGG - Intronic
1119663486 14:76467578-76467600 TCTGCCTCCCCAAACACAAGGGG - Intronic
1119916060 14:78403382-78403404 TCTGCTCTGGGAAATACCAGGGG - Intronic
1119981308 14:79084599-79084621 TCTGATTTTCCAAACAGCAGAGG - Intronic
1120369674 14:83617202-83617224 TCTGCCTTCCTTAATACCATAGG - Intergenic
1122243994 14:100388449-100388471 TCTTCTTTCCCACCTTCCAGAGG + Intronic
1122984004 14:105203875-105203897 TCTGCTGTCCCCTATTCCAGGGG + Intergenic
1125720833 15:41844458-41844480 TCTTCTTTTCCAGATCCCAGTGG + Exonic
1126065166 15:44820852-44820874 TCTGCTTTCAGGAATACCAAAGG - Intergenic
1126071865 15:44872541-44872563 CCTGCTCTCTCAAATACCAGAGG - Intergenic
1126086395 15:45014445-45014467 CCTGCTCTCTCAAAAACCAGAGG + Intergenic
1127074133 15:55309693-55309715 TCTGCTTTCCCAAATACCAGAGG - Intronic
1128362459 15:66972040-66972062 TCTGCTTTCCTAAATACCAGAGG - Intergenic
1128377960 15:67090668-67090690 TCTACCTTCCAAAATCCCAGGGG - Intronic
1130610696 15:85358233-85358255 GCTGGTTTCACAAATTCCAGTGG + Intergenic
1131420336 15:92299651-92299673 TCTGCTTTCCCAAATATCAGAGG + Intergenic
1135339441 16:21633599-21633621 CCTGCTCTCTTAAATACCAGAGG - Intronic
1135947180 16:26875440-26875462 TCTTCTTACCAAAACACCAGGGG + Intergenic
1137413701 16:48251934-48251956 TCTGCTTTGCCATATAGCTGAGG + Intronic
1138774161 16:59700761-59700783 TATGCTTTCACAATTACTAGGGG + Intergenic
1140589982 16:76340282-76340304 TATGCTTACCCAAATCCCACAGG + Intronic
1140844042 16:78869870-78869892 TCTTTTTTCCCAAATAACTGAGG + Intronic
1141950247 16:87335152-87335174 TCTGCTTTCCCAAGCTCCCGGGG + Intronic
1142127237 16:88416256-88416278 GCTCCGTTCCCAAAAACCAGAGG + Intergenic
1142805478 17:2369083-2369105 TCTCCTTTCCCAAGTATTAGGGG - Intronic
1145804325 17:27715661-27715683 CCTGCTCTTTCAAATACCAGAGG + Intergenic
1146310735 17:31766348-31766370 CCTGCTCTCTCAAATACCAGAGG + Intergenic
1147427866 17:40354941-40354963 TCTGGTTTCCAGAATAACAGGGG + Intronic
1148873491 17:50672886-50672908 TCTGCCATCCCAAATAACAGTGG + Intronic
1148897250 17:50846022-50846044 TCTGCTTTCCCTCATCCGAGTGG - Intergenic
1149047524 17:52265136-52265158 TCAGCTTTCCCCAATAAGAGTGG - Intergenic
1149209924 17:54290368-54290390 CCTGCTGTCTCAAATACCAGAGG + Intergenic
1149213467 17:54329028-54329050 CCTGCTCTCTCAAATCCCAGAGG + Intergenic
1149273926 17:55013942-55013964 TCTGCTTTCCCAAATACCAGAGG - Intronic
1149677729 17:58481221-58481243 TATCCTTTCCCAGATATCAGTGG + Intronic
1151568249 17:74912232-74912254 CCTGCTCTCTCAAATACCAGAGG + Intergenic
1153401707 18:4689496-4689518 TCTGCTTTCCCAAATACCAGAGG + Intergenic
1156305542 18:35875106-35875128 TTTGCTAACCCAAATACCTGAGG + Intergenic
1156580942 18:38374209-38374231 TCTGCTTTCCCAATTACTGCGGG - Intergenic
1156902433 18:42316064-42316086 TCTGCCTTCACTAAAACCAGAGG - Intergenic
1157490593 18:48121035-48121057 GCTGCTTTCCCCAAGACCAGGGG - Intronic
1157857341 18:51114984-51115006 CCTGCTCTCTCAAATACCAGAGG - Intergenic
1158785844 18:60711168-60711190 TCTGCTTTCCCAAATACCAGAGG + Intergenic
1158899374 18:61948630-61948652 TCTGCTTTAGCACATTCCAGGGG - Intergenic
1159300631 18:66561666-66561688 TTTGCATTTCCAAATACCACTGG - Intronic
1159821186 18:73146777-73146799 TCTGGTTTCCCATATACCTATGG + Intergenic
1162108130 19:8383338-8383360 CCTGCTCTCTCAAATACCAGAGG + Intronic
1164173715 19:22749530-22749552 TCTGCTTTCCCAAATACCAGAGG + Intergenic
1164269970 19:23664013-23664035 ACTTCTTTTCCATATACCAGAGG - Intronic
1164702123 19:30293117-30293139 TCTGCTCTCCCATCTCCCAGAGG + Intronic
1165847307 19:38826587-38826609 CCTGCTCTCTCAAATAACAGAGG + Intronic
1166431626 19:42732731-42732753 TCTGCCATCCCAAATACACGTGG - Intronic
1166452052 19:42910527-42910549 GCTGCCATCCCAAATACAAGTGG - Intronic
924973978 2:156495-156517 TCTGCTTTCCCAAATACCAAAGG - Intergenic
925147437 2:1590612-1590634 GCTGATTTCCCAAAGAACAGTGG - Intergenic
925890593 2:8430982-8431004 TCTGCTTTCTTAAATACCTCGGG - Intergenic
925949675 2:8898835-8898857 CCTGCTCTCTCAAATACCAGAGG - Intronic
926797766 2:16632919-16632941 TCTGCCTTCCCCAATAGCACAGG + Intronic
926864628 2:17343710-17343732 AGTGCTTTCCCAAATACCAGAGG + Intergenic
928131434 2:28654451-28654473 TGTGCTTTCCTAAATAAGAGCGG + Intergenic
928348005 2:30518687-30518709 TCTACTTTCCCAAATACCAGAGG + Intronic
928617395 2:33054114-33054136 CCTGGTCTCTCAAATACCAGAGG - Intronic
928677205 2:33661611-33661633 TCTGCTTTCCCAAATACCAGAGG + Intergenic
930038753 2:47104463-47104485 CCTGCTCTCTCATATACCAGAGG + Intronic
930593198 2:53354778-53354800 TTTGCTTTGTCAAAGACCAGGGG - Intergenic
930725260 2:54675576-54675598 TCACCTTTTCCAAACACCAGTGG - Intergenic
931984597 2:67729618-67729640 TGTGGTTTTCCAAACACCAGCGG + Intergenic
932356665 2:71073183-71073205 TCTGTTGTCACAAATACCACCGG - Intronic
932917834 2:75876519-75876541 TCTGCTTTCCCTAATACCAGAGG + Intergenic
933157952 2:78994798-78994820 GCTGCTTTCCCAGCCACCAGGGG + Intergenic
933175094 2:79165690-79165712 CCTGCTTTCCCAAATACCAGAGG - Intergenic
933200818 2:79446321-79446343 GCATCTTTCCCAAATACCAAGGG + Intronic
935263563 2:101375632-101375654 TCTGCTTCTCCAAACTCCAGTGG + Intronic
935748848 2:106212801-106212823 TCTGCTTTCCCAAATACCAGAGG + Intergenic
936802283 2:116283842-116283864 CCTACTCTCTCAAATACCAGAGG + Intergenic
938036321 2:128037894-128037916 TTTGCCTTCCCTAATACTAGAGG - Intergenic
938648693 2:133357613-133357635 TCTTTTGTCCCAAATATCAGAGG - Intronic
938805971 2:134807543-134807565 TCTGCTCTCTCAAATAGCAGAGG - Intergenic
939493489 2:142902988-142903010 TCTGCTTTCCCAAATACCAGAGG - Intronic
939895508 2:147786267-147786289 TCTGCTTCCCGAAATATAAGAGG + Intergenic
942831042 2:180237718-180237740 TCTGCTTTCCCAAATACGAGAGG + Intergenic
943133973 2:183889310-183889332 CCTGCTCTCTCAAATACCAGAGG + Intergenic
943623804 2:190178215-190178237 CCAGCTTTCCCGAATCCCAGGGG + Intronic
943748521 2:191487211-191487233 TTTTCTTTTCCACATACCAGAGG + Intergenic
944729224 2:202500782-202500804 CCTGCTCTCTCAAATACCAGAGG + Intronic
945916820 2:215713092-215713114 TCTGCTTTCCCAACTCTCAGGGG - Intergenic
946207148 2:218118067-218118089 CCTGCTCTCTCAAATACCAGAGG - Intergenic
946356517 2:219189078-219189100 TCTGTTTTCCCACTTACCACAGG + Intergenic
948408851 2:237743444-237743466 TCTGCTTTCCCAAGGACCCTGGG - Intronic
948670240 2:239563882-239563904 TCTGCACTCCCCAATTCCAGGGG + Intergenic
1168741239 20:193230-193252 TCTGCTTTCCCAAACACCAGAGG - Intergenic
1168925591 20:1576416-1576438 TTTGCCTTTCCAAATTCCAGAGG + Intronic
1168929469 20:1609443-1609465 TTTGCCTTTCCAAATTCCAGAGG + Intronic
1170397732 20:15946194-15946216 TGTCCTTTCCCAAATGCCACTGG + Intronic
1171320939 20:24243679-24243701 TCTGCTTTCCCTACTTACAGAGG + Intergenic
1173647560 20:44642900-44642922 TCTGCTTTCCCCCTTCCCAGAGG - Intronic
1173762453 20:45575615-45575637 CCAGCTTCCCCAAATAGCAGAGG + Intronic
1173843053 20:46171419-46171441 TCTGCAGTCCCAACTACCTGGGG + Intergenic
1174225267 20:48993727-48993749 TCTGCATTCTCAAGCACCAGAGG + Intronic
1174977272 20:55349669-55349691 TCTGCTTTCCCAAATACCAGAGG + Intergenic
1175943035 20:62546646-62546668 TCTACTTACCCAAATCCCAGGGG + Intergenic
1177263352 21:18755718-18755740 TCTGCTTTCCCAAATACTAGAGG - Intergenic
1177896416 21:26859527-26859549 TCTGCTTTCCCAAATACCACAGG + Intergenic
1178153892 21:29828993-29829015 TCTGGTTTCCAAAATTTCAGGGG + Intronic
1178702085 21:34842062-34842084 TCTGCTTTCCCACAACCTAGTGG - Intronic
1179258972 21:39741805-39741827 TCTGCTTTCCCAAATACCAGAGG - Intergenic
1181614428 22:24043117-24043139 TCTGCTGTTCCAAAAACCACTGG - Intronic
1183510659 22:38232828-38232850 TCTGCACTCCCAGATCCCAGAGG + Intronic
1184637117 22:45841733-45841755 TTTTCTTTCCCAAATACTACAGG + Intronic
1185063119 22:48617309-48617331 TTTGCTTTTCCAGATTCCAGAGG - Intronic
949895323 3:8764047-8764069 TATGCCTTCACAAATACCAAGGG - Intronic
951200528 3:19871955-19871977 TCTGCTTTCGCAAATACCAGAGG - Intergenic
951838080 3:27004038-27004060 TCTGCTTTCCCAAATACCAGAGG + Intergenic
952453248 3:33450514-33450536 CCTGCTCTCTCAAATACCAGAGG + Intergenic
952922065 3:38292389-38292411 TCTGCTTTCCCAAATACCAGAGG - Intronic
952940740 3:38442567-38442589 CCTGCTCTCTCAAATACCAGAGG - Intergenic
953622719 3:44547052-44547074 CCTGCTCTCTCAAATACCAGAGG - Intergenic
954107954 3:48419422-48419444 TCTGCCTTGCCAGATTCCAGAGG + Intronic
954587200 3:51746198-51746220 CCTGCTCTCTCAAATACCATGGG + Intergenic
954642938 3:52112870-52112892 ACTGTTTTCCAAAAGACCAGTGG + Intronic
955066149 3:55535251-55535273 CCTGCTTTCCAATATTCCAGAGG - Intronic
955403940 3:58613561-58613583 TCTGCTTACACAAAGGCCAGAGG - Intronic
955881095 3:63546786-63546808 TCTGCTTTTCAACATAACAGAGG - Intronic
957000122 3:74875363-74875385 TCTGATTTCCCAAAAACCTGAGG - Intergenic
958016082 3:87941766-87941788 TCTGCTTTCCCAAATAGCAGAGG - Intergenic
958486013 3:94709932-94709954 TCTGATTGCCAAATTACCAGGGG + Intergenic
958549018 3:95591613-95591635 CCTGCTCTCTCAAATACCAGAGG - Intergenic
958629640 3:96669807-96669829 TCTGCTTTTCCAAATACCATAGG - Intergenic
960539402 3:118847179-118847201 TCTACTCTCCCAGATACCAGAGG + Intergenic
962495615 3:135936354-135936376 CCCGCTTTCCCAAATACCAGAGG + Intergenic
962933637 3:140059774-140059796 TCTGCTTTCCAAAATTGCAATGG + Intronic
963187086 3:142430394-142430416 ACTACTTTAACAAATACCAGGGG + Intronic
963188117 3:142440735-142440757 TCTGCTTTCCCAAATACCAGAGG + Intronic
963696962 3:148574702-148574724 CCTGCTGTCTCAAATACCAGAGG + Intergenic
963847043 3:150170070-150170092 TATACATTCCCACATACCAGGGG - Intergenic
963915929 3:150858795-150858817 TCTGCTTTCCCAAATACCAGAGG + Intergenic
963992081 3:151667067-151667089 CCTTCTCTCTCAAATACCAGAGG - Intergenic
964064717 3:152563698-152563720 CCTGCTCTCTCAAATACCAGAGG + Intergenic
964916759 3:161849810-161849832 ACTGCTCTCTCAGATACCAGAGG - Intergenic
964953582 3:162325813-162325835 TCTGCTTGCCCAAATACCAGAGG + Intergenic
965054637 3:163697453-163697475 TCTGCTTTCCCAAATGCCAGAGG - Intergenic
965062949 3:163805443-163805465 CCTGCTCTCTCAAATACCAGAGG + Intergenic
965139408 3:164815359-164815381 CCTGCTCTCTCAAATACCAGAGG + Intergenic
965300201 3:166998645-166998667 TCTGCTAGCTCAAATACCAGAGG - Intergenic
966353668 3:179057291-179057313 TCTGCTTTCCCAAATACCAGAGG + Intronic
967362954 3:188652756-188652778 CCTCTTTTCTCAAATACCAGGGG - Intronic
967495541 3:190140573-190140595 TCAGCTTTCCCTATTACAAGTGG - Intergenic
967583874 3:191189635-191189657 CCTGCTCTCTCAAATACCAGAGG + Intergenic
967623713 3:191663034-191663056 TCTGCTTTCCCAAATACCAGAGG + Intergenic
969645122 4:8423675-8423697 TCTGCTTTCCCAAATACCAGAGG + Intronic
971280988 4:25242507-25242529 CCTGCTCTCTCAAATACCGGAGG - Intronic
972133087 4:35861291-35861313 CCTGCTCTCTCAAATACCAGAGG - Intergenic
972958126 4:44417387-44417409 TCTGTTTTCACAAATACAATGGG - Intronic
973046059 4:45535309-45535331 CCTGCTCTCTCAAATACCAGAGG + Intergenic
973209100 4:47595802-47595824 TCTGCTTTTCCAAAGTCCTGGGG - Exonic
973606193 4:52589789-52589811 TTTGCTTTCCCATATGCTAGGGG + Intergenic
974174712 4:58308229-58308251 CCTGCTCTCTCAAATACCAGAGG + Intergenic
974187527 4:58461965-58461987 TTTGCTCTCTCAAATACCAGAGG + Intergenic
974520630 4:62976469-62976491 TTTGCTTTCCCAAATACCAGAGG + Intergenic
974537332 4:63188510-63188532 GCTGATCTCTCAAATACCAGAGG + Intergenic
974838646 4:67278427-67278449 CCTGCTTTCTCAAATACCAGAGG - Intergenic
975313648 4:72929073-72929095 TCTGCTTTCCCAAATACCAGAGG - Intergenic
975595615 4:76046308-76046330 CCTGCTCTCTCAAATACCAGGGG - Intronic
977834725 4:101634406-101634428 CCTGCTCTCTCAAATACCAGAGG - Intronic
977884289 4:102239177-102239199 CCTGCTCTCTCAAATACAAGAGG + Intergenic
978586632 4:110281733-110281755 TCTGCTTTCTCAAATACCAGAGG - Intergenic
978622847 4:110651627-110651649 TCTGCGTTCCCAAAGCCGAGTGG + Intergenic
978909728 4:114049270-114049292 TGTGCTTTCTCAAATACCAGAGG + Intergenic
980290697 4:130845353-130845375 CCTGCTCTCTCAAATACCAGAGG - Intergenic
980444376 4:132886587-132886609 TCTGCTTTCCCAAATACCAGAGG + Intergenic
980557909 4:134432544-134432566 ACTGCTTTTCCATATACCAAAGG - Intergenic
980872632 4:138627027-138627049 TCTGCTTTCCCAAATACCAGAGG - Intergenic
981742228 4:148014813-148014835 ACTCCTTTCCCAAGTTCCAGTGG - Intronic
981855237 4:149281651-149281673 TTTGCTTTCAGAAATATCAGAGG + Intergenic
983666865 4:170192744-170192766 TCTGCTTCCCCAAATACCAGAGG - Intergenic
983834736 4:172373313-172373335 CCTGCTCTCTCAAATACCAGAGG - Intronic
984723906 4:183001850-183001872 TCTGCTTTCCCAAATACCAGAGG + Intergenic
984917654 4:184738315-184738337 TGTGCTCTCTCAAATACCAGAGG + Intergenic
985383722 4:189423027-189423049 TTTGTTTTCCCAATTACAAGTGG + Intergenic
986584219 5:9297911-9297933 GCTGTTTTCCCAAATACCCTAGG - Intronic
986990237 5:13543853-13543875 TCTGCCTCCCCAAGAACCAGAGG - Intergenic
987293965 5:16533849-16533871 TCCACTTTCCAAAATAGCAGTGG - Intronic
987545041 5:19303467-19303489 CCTGCTCTCTCAAATACCAGAGG - Intergenic
987818073 5:22929991-22930013 CCTGCTCTCTCAAATATCAGAGG + Intergenic
987930092 5:24391035-24391057 CCTGGTCTCTCAAATACCAGAGG + Intergenic
988357994 5:30201484-30201506 GCTGCTCTCTCAAATACCAGAGG + Intergenic
988518987 5:31929521-31929543 TGTGCTTTCACATATGCCAGTGG - Intronic
988591805 5:32555983-32556005 CCTGCTCTCTCAAATACCAGAGG - Intronic
989957542 5:50374214-50374236 CCTGCTCTCTCAAATACCAGAGG + Intergenic
990332223 5:54739486-54739508 TCTCCATTCCCAAATTTCAGTGG + Intergenic
992049570 5:72930188-72930210 CCTCCTCTCTCAAATACCAGAGG + Intergenic
992455399 5:76911377-76911399 CCTGCTCTCCCAAACACCAGAGG + Intronic
992942674 5:81777937-81777959 TCTGCTATGCCAAAATCCAGAGG + Intergenic
994002621 5:94798398-94798420 TCTGCTTTCAAAAATGCCAGAGG + Intronic
994231532 5:97314396-97314418 CCTGCTCTCTCAAATACAAGAGG - Intergenic
994454224 5:99984503-99984525 TCTGCTCTCTCAAATACCAGAGG + Intergenic
994907182 5:105856162-105856184 TCTGCTTTCCAAAAAACAAATGG + Intergenic
995465809 5:112448506-112448528 TCTGCTTTCCCAAATACCAGAGG + Intergenic
995583217 5:113621927-113621949 CTTGCTCTCTCAAATACCAGAGG - Intergenic
995706629 5:114994263-114994285 CCTGCTCTCTCAAATACCAGAGG + Intergenic
996584429 5:125069035-125069057 TTTGATATCCCAAGTACCAGAGG + Intergenic
996680412 5:126224048-126224070 TCTGCTCTCTCAAATGCCAGAGG + Intergenic
998111658 5:139507202-139507224 CCTGCTCTCTCAAATACCAGAGG + Intergenic
998226882 5:140334083-140334105 TCTTCTTACCCAGATACCATCGG + Exonic
999060518 5:148629457-148629479 TCTGCTTTACTAAAGTCCAGGGG + Intronic
999827014 5:155283224-155283246 TCTTCTTTTCCACAGACCAGAGG - Intergenic
1000085426 5:157883899-157883921 CCTGCTCTCTCAAATACCAGAGG + Intergenic
1000469959 5:161629142-161629164 GATCCTTTGCCAAATACCAGAGG + Intronic
1003134433 6:3423396-3423418 TCAGCTTCCCCAAATGCCATCGG - Intronic
1004442815 6:15670205-15670227 TCTGCTTTCCCATATAACATTGG + Intergenic
1004531570 6:16459559-16459581 CCTGCTCTCTCAAATACCAAAGG + Intronic
1004812441 6:19275099-19275121 CCTGCTCTCTCAAATACCAGAGG + Intergenic
1007030232 6:38620281-38620303 CCTGCTCTCTCAAATACCAGAGG + Intronic
1007510380 6:42370156-42370178 TATGCTTTCCCAAATTCGAATGG - Intronic
1008045120 6:46843826-46843848 TCAGTTTACCCAAATACAAGAGG - Intergenic
1008270648 6:49485082-49485104 TCTCCTGCCCCAAATGCCAGCGG - Intronic
1008582208 6:52917521-52917543 TCTGCTTTCCCAAATACCAGAGG - Intergenic
1009385753 6:63082921-63082943 TCTGCTCCCTGAAATACCAGAGG - Intergenic
1009407515 6:63329355-63329377 CCTGCTCTCTCAAATACCAGAGG - Intergenic
1009471001 6:64028505-64028527 CCTGCTCTCTCAAATACCAGAGG + Intronic
1009544954 6:65009424-65009446 TCTGCTTTCCCAAATACCGGAGG + Intronic
1009872971 6:69472006-69472028 CCTGCCCTCTCAAATACCAGAGG + Intergenic
1010270015 6:73907683-73907705 CTTGCTCTCTCAAATACCAGAGG + Intergenic
1010893624 6:81341642-81341664 TCTGCTTTCCCAAATACCAGAGG + Intergenic
1011076945 6:83447848-83447870 TCTGCTTTCCCAAATACCAGAGG + Intergenic
1011189618 6:84715779-84715801 TCTGCTTTCCCAAATACCAGAGG - Intronic
1011374858 6:86677508-86677530 CCTGCTCTCTCAAATACCAGAGG - Intergenic
1011539691 6:88416698-88416720 TCTGCTTTCCCAAATACCAGAGG - Intergenic
1012441351 6:99264928-99264950 CCTGCTTTCTCAAATACCAGAGG - Intergenic
1012849390 6:104428743-104428765 TCTGCCTTCCAAAGTACCACGGG + Intergenic
1012867022 6:104630789-104630811 TCTGCTTTCAAATATACCCGGGG + Intergenic
1013022402 6:106232795-106232817 TCTGCTTTCCCAAATACCAGAGG + Intronic
1013376778 6:109524601-109524623 TCTGATTTCCATCATACCAGAGG + Intronic
1013543712 6:111135513-111135535 TCCGCTTTCCCAAATACTAGAGG + Intronic
1013907655 6:115237270-115237292 CCTGCTTTCTCAAATACCAGAGG - Intergenic
1015865318 6:137721475-137721497 TCTGCTTTCCCAAATACCAGAGG - Intergenic
1016184211 6:141180034-141180056 CCTGCTCTCTCAAATACCAGAGG + Intergenic
1016208484 6:141500475-141500497 TTTGCTTTCCCAAAAATTAGTGG + Intergenic
1016343084 6:143083499-143083521 TCCACTTTCCCAAATACTAGAGG - Intronic
1016444552 6:144118860-144118882 TCTGCTTTCCCAAATACCAGAGG - Intergenic
1016611333 6:145993224-145993246 ACTGCTTTCTCAAATAACAATGG + Intergenic
1016612653 6:146009922-146009944 TCTGCTTTCTTACAAACCAGAGG + Intergenic
1017101147 6:150850925-150850947 CCTGCTCTCTCAAATACCAGAGG + Intergenic
1018761210 6:166895724-166895746 TCTGCTTTCCCAAATACCAGAGG + Intronic
1019042998 6:169121520-169121542 TCTGCTAGCTCAAATACCTGAGG + Intergenic
1020780170 7:12507845-12507867 CCAGTTTTCCCAAATACCATGGG + Intergenic
1021356399 7:19657148-19657170 CCTGCTCTCTCAAATACCAGAGG - Intergenic
1021904287 7:25317762-25317784 TCTGCTTTGCCATATATTAGTGG + Intergenic
1022432306 7:30337520-30337542 TCTAGTTTCCCAAATCTCAGGGG - Intronic
1023663212 7:42492162-42492184 TCTGCATTCTCAAATAAAAGTGG + Intergenic
1024870594 7:53958830-53958852 ACTGCTCTCTCAAATACCAGAGG - Intergenic
1027288566 7:76676961-76676983 TCTTCCTTCCTAAATCCCAGTGG + Intergenic
1027381133 7:77610755-77610777 TCTGTTTTAGAAAATACCAGAGG + Exonic
1027778261 7:82492763-82492785 ACTGTTTTCCCATATCCCAGTGG - Intergenic
1028495036 7:91452452-91452474 CTTGCTCTCTCAAATACCAGAGG - Intergenic
1028588416 7:92473173-92473195 TCTGCTTTCCCAAATACCAGAGG - Intronic
1029322686 7:99778974-99778996 TCATCTTTCCCACATACCTGAGG - Intronic
1030337462 7:108341920-108341942 TCTGCTTTCCCAAATACCATAGG + Intronic
1030843328 7:114381621-114381643 TCTGCTTTCCCAAATACCAGAGG - Intronic
1031264719 7:119568288-119568310 TCTGCTTTCCCAAATACCAGAGG + Intergenic
1031731969 7:125311704-125311726 CCTGCTCTCTCAAATACCAGAGG + Intergenic
1032835575 7:135669580-135669602 TCTGATTTCCCAAATACATACGG - Intronic
1033011579 7:137628186-137628208 TATTCTCTCCCAAAAACCAGAGG - Intronic
1033759047 7:144421042-144421064 CCTGCTCTCTCAAATACCAGAGG - Intergenic
1034579784 7:152032397-152032419 CCTGCTCTCTCAAATACCAGAGG - Intronic
1035685376 8:1520105-1520127 TCTGCTTCCCAACATACCATGGG + Intronic
1037571157 8:20158771-20158793 TCTGCTTTCCCAAATACCAGAGG + Intronic
1037854081 8:22357329-22357351 TCTGCTTAGCCAGAGACCAGTGG - Exonic
1038430593 8:27496511-27496533 CCTGCTCTCTCAAATACCAGAGG - Intronic
1038638979 8:29308850-29308872 CCTGCTCTCTCAAATACCAGAGG + Intergenic
1038656568 8:29457983-29458005 TGGGCTTTGCCAAATACCAATGG - Intergenic
1039692993 8:39881616-39881638 CCTGCTCTCTCAAATACCAGAGG - Intergenic
1039999495 8:42564274-42564296 CCTGCTCTCTCAAATACCAGAGG - Intergenic
1040527583 8:48238469-48238491 TCTGCTTTCCCAAATACCAGAGG - Intergenic
1040649147 8:49430207-49430229 CCTGCTCCCTCAAATACCAGAGG + Intergenic
1040667684 8:49653133-49653155 CCTGCTCTCTCAAATACCAGAGG - Intergenic
1040796642 8:51295394-51295416 CCTTCTCTCTCAAATACCAGAGG - Intergenic
1040953593 8:52958533-52958555 CCTGCTCTCTCAGATACCAGAGG + Intergenic
1040964873 8:53073214-53073236 CCTGCTCTCTCAAATACCAAAGG - Intergenic
1040971273 8:53139699-53139721 CCTGCTCTCTCAAATACAAGAGG - Intergenic
1041002103 8:53463463-53463485 CCTGCTCTCTCAAATACCAGAGG + Intergenic
1041663701 8:60422815-60422837 CCCGCTTTCCCAAATACCAGAGG - Intergenic
1042420396 8:68581920-68581942 TGTGCTTTCCCAAATATCACAGG - Intronic
1042772099 8:72391829-72391851 CCTGCTCTCTCAAATACCCGAGG + Intergenic
1043257244 8:78151449-78151471 CCTGCTCTCTCAAATACCAGAGG + Intergenic
1043490132 8:80740631-80740653 TCTGCTTTCCCAAATACCAGAGG + Intronic
1044005246 8:86930637-86930659 CCCGCTCTCTCAAATACCAGAGG - Intronic
1044316427 8:90753979-90754001 TTTGTTTTCCCAAATACAAAAGG + Intronic
1046113303 8:109753135-109753157 GCTGCTTTCCAAAATACTATGGG - Intergenic
1046516801 8:115272620-115272642 TCTGCTGGCTCAAATAACAGAGG + Intergenic
1047444298 8:124905883-124905905 TCTGCTTTCACAATTTCCTGGGG - Intergenic
1047807923 8:128378696-128378718 TCTACTCTCCCAGATACCAGAGG - Intergenic
1051163604 9:14236977-14236999 TCTTCTTCCCCTAACACCAGTGG + Intronic
1052194412 9:25693974-25693996 TCTGCTTTCCCAGTTACTTGTGG - Intergenic
1052289689 9:26827238-26827260 CCTGCTCTCTCAAATACCAGAGG + Intergenic
1053106754 9:35416128-35416150 TTGGCTTTCTCAAATGCCAGTGG - Intergenic
1053652452 9:40182930-40182952 TCAGTTTACCCAAATACAAGAGG + Intergenic
1053840258 9:42184308-42184330 TCTGCTTCCCAGAAGACCAGAGG - Intronic
1053902852 9:42812237-42812259 TCAGTTTACCCAAATACAAGAGG + Intergenic
1054097307 9:60915056-60915078 TCTGCTTCCCAGAAGACCAGAGG - Intergenic
1054118713 9:61190685-61190707 TCTGCTTCCCAGAAGACCAGAGG - Intronic
1054532129 9:66193291-66193313 TCAGTTTACCCAAATACAAGAGG - Intergenic
1055160699 9:73123231-73123253 ACTGCTTTCCCTCATACAAGAGG + Intergenic
1056392595 9:86153399-86153421 ACTGCTCTCTCAAATACCAGAGG - Intergenic
1057808659 9:98240695-98240717 TGTGCTTTCCCACACCCCAGGGG - Intronic
1059857379 9:118414929-118414951 TGTGCTTTCCCAAATGAAAGGGG + Intergenic
1062550409 9:137083498-137083520 TGTGCTTCCCCAAGAACCAGTGG + Exonic
1188097712 X:26043997-26044019 CCTGTTCTCTCAAATACCAGAGG + Intergenic
1189414405 X:40802035-40802057 CCTGCTAGCCCAAATACCTGAGG - Intergenic
1189783831 X:44542304-44542326 TCTGCTTTCCCAAAGGCCCGGGG + Intronic
1191166927 X:57401443-57401465 TCTGCTTTCCCAAATGTCAGAGG - Intronic
1192482570 X:71498328-71498350 CCTGCTCTCTCAAATACCAGAGG - Intronic
1192939809 X:75900813-75900835 TCTGCTTTCCCAAATACCAGAGG - Intergenic
1193306860 X:79960547-79960569 TCTGCTTTCCCAAATACCAGAGG + Intergenic
1195439754 X:104886634-104886656 TCTGCTCTCTCAAATACCAGAGG + Intronic
1195535116 X:106001571-106001593 TCTGCTTTCCCAAATACCAGAGG + Intergenic
1195656765 X:107338967-107338989 TCTGCTCTCCCACATACCCCTGG + Intergenic
1196503679 X:116414930-116414952 TCTACTTACCAATATACCAGAGG + Intergenic
1196527182 X:116740432-116740454 TCTGCTTTCCCAAATACCAAAGG - Intergenic
1196527352 X:116741566-116741588 TCTGCTTTCCCAAATACCAGAGG + Intergenic
1197453136 X:126642478-126642500 TCTTCTTTTCCAAATGCCATGGG + Intergenic
1197954643 X:131932566-131932588 TCTGCTTTCCCAAATACCAGAGG - Intergenic
1199832221 X:151558336-151558358 CCTGCTCTCTCAAATACCAGAGG - Intergenic
1200525076 Y:4264582-4264604 TTTGCTTTCACAAATACTGGTGG + Intergenic
1200851494 Y:7888252-7888274 TCTACTTTCCCAAATACCAGAGG - Intergenic
1200880635 Y:8208523-8208545 CCTGCTCTCTCAAATACCAGAGG - Intergenic
1200959474 Y:8983752-8983774 CCTGCTGCCTCAAATACCAGAGG + Intergenic
1201311883 Y:12604841-12604863 CTTGCTCTCTCAAATACCAGAGG - Intergenic
1201403932 Y:13631683-13631705 ACTGCTCTCTGAAATACCAGAGG + Intergenic
1201407352 Y:13662481-13662503 ACTGCTCTCTCAAATTCCAGAGG - Intergenic
1201429863 Y:13892806-13892828 CTTGCTCTCTCAAATACCAGAGG + Intergenic
1201455295 Y:14162114-14162136 ACTGCTCTCTCAAATATCAGAGG + Intergenic
1201473010 Y:14354045-14354067 TCTGTTCTCTTAAATACCAGAGG - Intergenic
1201568425 Y:15389964-15389986 CCTGCTCTCTCAAATACCTGAGG - Intergenic
1201631425 Y:16075135-16075157 CCTGCTCTCTCAAATACCAGAGG + Intergenic
1201729422 Y:17188754-17188776 CCTGCTCTCTCAAATACCAGAGG - Intergenic
1201905738 Y:19084210-19084232 TCTACTTTCCCAAATACCAGAGG + Intergenic
1201911241 Y:19135423-19135445 TCTGCTTTCTCAAATACCAGAGG + Intergenic
1202192434 Y:22259020-22259042 CCTGCTCTCTCAAATGCCAGAGG - Intergenic
1202258055 Y:22941186-22941208 CCTGCTCTCTCAAATACCAGAGG + Intergenic
1202411045 Y:24574944-24574966 CCTGCTCTCTCAAATACCAGAGG + Intergenic
1202459736 Y:25095128-25095150 CCTGCTCTCTCAAATACCAGAGG - Intergenic