ID: 1196527355

View in Genome Browser
Species Human (GRCh38)
Location X:116741577-116741599
Sequence AAATACCAGAGGAAGCAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 714
Summary {0: 57, 1: 121, 2: 79, 3: 63, 4: 394}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196527351_1196527355 -4 Left 1196527351 X:116741558-116741580 CCTTATACTCTGCTTTCCCAAAT 0: 51
1: 27
2: 25
3: 150
4: 973
Right 1196527355 X:116741577-116741599 AAATACCAGAGGAAGCAGAGTGG 0: 57
1: 121
2: 79
3: 63
4: 394
1196527346_1196527355 22 Left 1196527346 X:116741532-116741554 CCTCTCTATACCCAGCTGTACCT No data
Right 1196527355 X:116741577-116741599 AAATACCAGAGGAAGCAGAGTGG 0: 57
1: 121
2: 79
3: 63
4: 394
1196527350_1196527355 -3 Left 1196527350 X:116741557-116741579 CCCTTATACTCTGCTTTCCCAAA 0: 52
1: 30
2: 12
3: 62
4: 1035
Right 1196527355 X:116741577-116741599 AAATACCAGAGGAAGCAGAGTGG 0: 57
1: 121
2: 79
3: 63
4: 394
1196527348_1196527355 11 Left 1196527348 X:116741543-116741565 CCAGCTGTACCTAACCCTTATAC 0: 38
1: 33
2: 42
3: 112
4: 192
Right 1196527355 X:116741577-116741599 AAATACCAGAGGAAGCAGAGTGG 0: 57
1: 121
2: 79
3: 63
4: 394
1196527344_1196527355 30 Left 1196527344 X:116741524-116741546 CCGTTGTCCCTCTCTATACCCAG No data
Right 1196527355 X:116741577-116741599 AAATACCAGAGGAAGCAGAGTGG 0: 57
1: 121
2: 79
3: 63
4: 394
1196527349_1196527355 2 Left 1196527349 X:116741552-116741574 CCTAACCCTTATACTCTGCTTTC 0: 40
1: 37
2: 64
3: 877
4: 1690
Right 1196527355 X:116741577-116741599 AAATACCAGAGGAAGCAGAGTGG 0: 57
1: 121
2: 79
3: 63
4: 394
1196527345_1196527355 23 Left 1196527345 X:116741531-116741553 CCCTCTCTATACCCAGCTGTACC No data
Right 1196527355 X:116741577-116741599 AAATACCAGAGGAAGCAGAGTGG 0: 57
1: 121
2: 79
3: 63
4: 394
1196527347_1196527355 12 Left 1196527347 X:116741542-116741564 CCCAGCTGTACCTAACCCTTATA 0: 39
1: 34
2: 14
3: 12
4: 96
Right 1196527355 X:116741577-116741599 AAATACCAGAGGAAGCAGAGTGG 0: 57
1: 121
2: 79
3: 63
4: 394

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196527355 Original CRISPR AAATACCAGAGGAAGCAGAG TGG Intergenic
900749275 1:4384197-4384219 AAACACCAGAAGCAGGAGAGAGG + Intergenic
900763400 1:4487886-4487908 AAGTTCCAGAGGAAGGAGTGAGG + Intergenic
901167241 1:7229490-7229512 GAGGACCAGAGGAAGCGGAGAGG + Intronic
902603191 1:17554022-17554044 AAAGACCAGAGGAAGTGCAGAGG + Intronic
903433494 1:23327861-23327883 AAAAACCTGAGGAAGGTGAGGGG + Intronic
904013595 1:27404214-27404236 AAACACCAGAGGTGGCTGAGTGG + Exonic
904479994 1:30787620-30787642 AAAGCCCAGTTGAAGCAGAGAGG - Intergenic
905543161 1:38776344-38776366 AATTTCCTGAGGATGCAGAGTGG - Intergenic
905950550 1:41947001-41947023 AAATACCAGAGGAAACAGAGTGG + Intronic
905973653 1:42159485-42159507 ATGTACCAGAGGAAACATAGAGG - Intergenic
906409771 1:45569126-45569148 AAACACCTGAGGATGGAGAGTGG - Exonic
906507081 1:46388297-46388319 AAATACCAGAGGAAGCAGAGTGG - Intergenic
906518246 1:46452238-46452260 AGAGACAAGAGGAAGCAGAGTGG + Intergenic
906566621 1:46805594-46805616 AAATACCCCAGGGAGCAGAGAGG - Intronic
906583591 1:46956364-46956386 AAATACCAGAGGAAGCAGAGTGG + Intergenic
907111266 1:51928558-51928580 TAATACCTGAGACAGCAGAGGGG + Intronic
907505428 1:54914747-54914769 AAATACCAGAGGAAGCAGAGTGG - Intergenic
908300630 1:62758160-62758182 AAATACCAGAGGAAGCAGAATGG + Intergenic
908642027 1:66234810-66234832 AAATCACAAAGGAAGCAGAAGGG - Intronic
908659559 1:66422264-66422286 AAATATCAGAGGAAGCAGAATGG - Intergenic
909512439 1:76469867-76469889 AAATACTAGAGGAGCAAGAGGGG - Intronic
910168118 1:84349059-84349081 AAGTATCAGGAGAAGCAGAGGGG + Intronic
910351812 1:86307284-86307306 AAAGACCAGGGGAAGAAGAAAGG - Intergenic
910397235 1:86805258-86805280 AAATACCAGAGGAAGCAGAATGG - Intergenic
910850774 1:91648156-91648178 AAACACCAGATGTAGCAAAGAGG - Intergenic
911129564 1:94374918-94374940 AAATACCAGAGGAAGCAGAATGG - Intergenic
911751619 1:101502789-101502811 AAATACCAGAGGAAGCAGAACGG + Intergenic
912021513 1:105112920-105112942 AAATACCAGAGGAAGCAGAATGG + Intergenic
912211094 1:107557670-107557692 AAATTCCAGAGGAAAAAGACTGG + Intergenic
912463761 1:109855166-109855188 AAATACCAGAGGAAGCAGAGTGG - Intergenic
912738177 1:112168647-112168669 AACAACCAGAGGAGGCAGACAGG - Intergenic
913382829 1:118229437-118229459 AAATACCAGAGGAAACAGAATGG + Intergenic
913468856 1:119170825-119170847 AAATACCAGAGGAAGCAGAGTGG - Intergenic
913469747 1:119176200-119176222 AAATACCAGAGGAAGCAGAATGG + Intergenic
914691295 1:150030448-150030470 AATTCCCTGAGGAAGCAGAAGGG - Intergenic
915260790 1:154675390-154675412 AAATACCAGAGGAAGCAGAATGG + Intergenic
915359345 1:155277017-155277039 AAATACTAGGGGAAGCAGTTCGG + Intronic
915401298 1:155623896-155623918 AGATACCAGAGGAAGCAGAATGG - Intergenic
916083886 1:161254273-161254295 AAATGCCAGAGGAAGCAGAATGG + Intergenic
916114658 1:161476466-161476488 AAATACCAGAGGAAGCAGAATGG + Intergenic
916601400 1:166297034-166297056 AGATACCAGACTAAGCATAGAGG - Intergenic
916912791 1:169368573-169368595 AAATGCCAAATGAAGCGGAGGGG - Intronic
916939748 1:169665910-169665932 AAATACCAGAGAAGGCAGAATGG + Intronic
917086338 1:171308741-171308763 AAATACCAGAGGAAGCAGAATGG + Intergenic
917280103 1:173371758-173371780 AAATACCAGAGGAAGCAGAATGG + Intergenic
917655296 1:177119905-177119927 AAATAGCAGAGGAAGAAATGGGG + Intronic
917793308 1:178513640-178513662 AAATAACAGAGATAGTAGAGAGG + Intronic
918293118 1:183128688-183128710 ATAGACTAAAGGAAGCAGAGAGG + Exonic
918297632 1:183171896-183171918 AAACAGCAGAGGGACCAGAGTGG + Intergenic
918910112 1:190556438-190556460 AAATACCTGAGGTAGGTGAGGGG + Intergenic
919052616 1:192529976-192529998 AAATTCCAGAGGGAGGAGAATGG + Intergenic
919206491 1:194425894-194425916 AACTACTAGAGGAAGCAGAATGG + Intergenic
919558920 1:199094425-199094447 AAATACCAGAGGAAGCAGAATGG + Intergenic
921019917 1:211226088-211226110 AAATACGAGAGGAAGCAAACGGG + Intergenic
921072158 1:211669884-211669906 AAAGACCAGAAGAAGGGGAGGGG - Intronic
921083420 1:211763697-211763719 AAATAGCAAAAGAAACAGAGGGG - Intronic
921092575 1:211857647-211857669 AAATACCAGAGGAAGCAGAGTGG - Intergenic
921148437 1:212380744-212380766 AAAAACCACAGGAATCAAAGTGG - Intronic
922684522 1:227628963-227628985 AAATACCAAAGGAAGCAGAGTGG - Intronic
923343360 1:233026353-233026375 AAGTAGTAGATGAAGCAGAGAGG + Intronic
923951909 1:238965173-238965195 AAAAAACACAGGAAGCATAGAGG - Intergenic
924320055 1:242839599-242839621 AAATACCAGCTGAAGCAGCGTGG + Intergenic
924582351 1:245333408-245333430 ACAAACCAGACGAAGTAGAGTGG + Intronic
1062935906 10:1388952-1388974 AAATACCAGTGGAACAAAAGGGG + Intronic
1063609208 10:7548819-7548841 AGCTACCACTGGAAGCAGAGTGG + Intergenic
1064266637 10:13830663-13830685 ACTTACCAGAGAAAGCAAAGCGG + Intronic
1064466626 10:15589258-15589280 AAAGACCACAGAAAGCATAGAGG - Intronic
1064777046 10:18790239-18790261 AAAGACTAGAGGAATCACAGAGG - Intergenic
1065082643 10:22142692-22142714 AAATACCAGAGGAAGCAGAATGG + Intergenic
1065199404 10:23299081-23299103 AAATACCAGAGGAAGCAGAGTGG - Intronic
1065987098 10:30965748-30965770 GACTACTAGAGGAAGGAGAGAGG + Intronic
1066614358 10:37280751-37280773 AAATACCAAAGGAAGCAGAATGG - Intronic
1066679076 10:37918925-37918947 AAATAACAGAGGAAGAAAAAAGG + Intergenic
1068500533 10:57836575-57836597 AAATACCAGAGGAAGCAGAATGG + Intergenic
1068554018 10:58437779-58437801 AAAGATCAGAGCAGGCAGAGAGG + Intergenic
1068791654 10:61036665-61036687 AAATACCAGAGGAAGGAGAGTGG - Intergenic
1068855815 10:61796138-61796160 AACTTCCAAAGAAAGCAGAGTGG - Intergenic
1069137119 10:64780918-64780940 AAATACCAGAGGAAGCAGAATGG - Intergenic
1069363420 10:67670779-67670801 AACTACCATAAGAAGCAGAGAGG - Intronic
1069927365 10:71860124-71860146 AGATCCCAGAGGGAGCAGTGAGG - Intergenic
1071938210 10:90554680-90554702 AGAGACGAGAGGAAGCGGAGGGG + Intergenic
1072305906 10:94106988-94107010 ATATAACCAAGGAAGCAGAGGGG - Intronic
1072377930 10:94837079-94837101 AAATACCAGAGGAAGCAGAGTGG - Intronic
1072471757 10:95719931-95719953 AAATACCAGAGGAAGCAGAGTGG - Intronic
1072665485 10:97389582-97389604 AATTTCCAGAGGAAACAGTGGGG + Intronic
1072777120 10:98209431-98209453 AAATATCTGAGCAAGCAGAAGGG - Exonic
1073100740 10:101005270-101005292 AAACACAAGAGCAAGCAGACCGG - Intronic
1073970975 10:109045164-109045186 AAATACCAGAGGAAGCAGAATGG + Intergenic
1075146546 10:119887375-119887397 AAATACCAGAGGAAGCAGAATGG + Intronic
1075941549 10:126394624-126394646 AATCACCAGAGGAAGCATAGTGG + Intergenic
1076495444 10:130894417-130894439 ATATACCAGAGGAACGTGAGAGG + Intergenic
1078797256 11:14604713-14604735 AATTACCAGAGGAAGGAGGGAGG - Intronic
1079155893 11:17947708-17947730 AAATACCAGAGCTAACATAGTGG - Intronic
1079601150 11:22314644-22314666 AAATACCAGAGGAAGCAGAGTGG - Intergenic
1079730992 11:23937688-23937710 CAATACCAGAGGAAGCAGAATGG - Intergenic
1079811443 11:25003417-25003439 AAATACCAGAGGAAGCAGAATGG - Intronic
1080784963 11:35466921-35466943 AAATACCATAGGATGGGGAGGGG - Intronic
1080987563 11:37487765-37487787 AAATTCCAGAAGAAGCACAGAGG - Intergenic
1081421655 11:42878860-42878882 AAATACCAGAGGAAGCAGAATGG + Intergenic
1082865572 11:57897166-57897188 AAATACTAGAGAAAGCTGGGAGG - Intergenic
1082953293 11:58841251-58841273 CAATACAAAAGGAAGCACAGTGG + Intronic
1083069667 11:59964270-59964292 AAATTCAAGAGGAAGTACAGGGG - Intergenic
1083314279 11:61804719-61804741 ATATACCACTGGAAGTAGAGAGG + Exonic
1084211239 11:67623910-67623932 AAATACCAGAGGAAGCAGAATGG + Intergenic
1084352052 11:68609267-68609289 AAACGCCAGAGGGAGAAGAGGGG - Intronic
1084385013 11:68838106-68838128 ATATCCCTCAGGAAGCAGAGCGG + Intronic
1085601612 11:77860802-77860824 AAATACCAGAGGAAGTAGAGTGG - Intronic
1086009064 11:82076893-82076915 AAACCCAAGAGGTAGCAGAGAGG + Intergenic
1086317618 11:85610384-85610406 AAATATCAGAGGAAGCAGAATGG + Intronic
1086441829 11:86836091-86836113 AAATACCAGAGGAAGCAGAGTGG - Intronic
1087075211 11:94122072-94122094 AAATACCAGAGGAAGCAGAATGG + Intergenic
1087547022 11:99597809-99597831 AAATACCGGAGAAAGCTGTGGGG - Intronic
1087611695 11:100442345-100442367 AACAACCAGAAGAAGGAGAGTGG - Intergenic
1087683115 11:101236776-101236798 AAATACCAGAGAAAGCAGAATGG - Intergenic
1087810407 11:102604104-102604126 AAATATCAGAGGTTGCAGTGGGG - Intronic
1088492767 11:110403274-110403296 AAATACCAGAGGAAGCAAAATGG + Intergenic
1088888505 11:114026495-114026517 AAAGCCTAGAGGGAGCAGAGAGG + Intergenic
1088930661 11:114348037-114348059 AGATACCAGAGGAAGCAGAATGG - Intergenic
1089873954 11:121702090-121702112 TTATAGCAGAGGAAGGAGAGGGG + Intergenic
1090234372 11:125136424-125136446 AGAGAACAGAGGAAGCAGAGAGG + Intergenic
1090452241 11:126817191-126817213 TAAGACCAGAGGAGGCAGAGGGG + Intronic
1090820639 11:130338188-130338210 AAAAGCCAGAGGAATTAGAGAGG + Intergenic
1092270562 12:7019975-7019997 AAATACCAAAGTCAGCAAAGTGG - Intronic
1092294228 12:7185406-7185428 AAATACCAGAGGAAGCAGAGTGG + Intergenic
1092469285 12:8763961-8763983 AAATGCCAGAGGAAGCAGAGTGG - Intronic
1092472543 12:8792160-8792182 AAACACCAGAGGAAGCAGAATGG + Intergenic
1093023003 12:14220251-14220273 AGAAACCAGAGGAAGCAGAATGG + Intergenic
1093345472 12:18035170-18035192 ATATACCAGAGGAAGCAGAATGG + Intergenic
1094086684 12:26600931-26600953 AAATAGAAGAGAAAGCAAAGAGG - Intronic
1094103043 12:26784147-26784169 AAATAACAGGGGAAACAGAGTGG + Intronic
1094806622 12:34100436-34100458 AAATACCAGAGGAAGCAGAGTGG + Intergenic
1095125469 12:38471902-38471924 AAATACCAGAGGAAGCAGAGTGG + Intergenic
1095284089 12:40388452-40388474 AAATACCAGGGGAAGCAGAGTGG + Intergenic
1095397828 12:41780839-41780861 CAATATCACAGGAAGGAGAGGGG + Intergenic
1096351912 12:50907746-50907768 AAATACCAGAGGAAGCAGAGTGG - Intergenic
1096443989 12:51672020-51672042 AAATTCCAGAGGAGGTAGAAAGG - Intronic
1097187637 12:57204234-57204256 AAATACCAGAGGGGGCAGTTTGG + Intronic
1097377097 12:58854820-58854842 AAATACCAGAGAAAGCAGAGTGG - Intergenic
1098956369 12:76693771-76693793 AAATACCAGAGAAAGCAGAATGG - Intergenic
1099743976 12:86678406-86678428 AAAAAAAAGAGGAAACAGAGTGG - Intronic
1099975819 12:89544660-89544682 AAATAGCTGAGAAAGGAGAGAGG - Intergenic
1100092365 12:90986495-90986517 AAATACCAGAGGAAGCAGAATGG + Intronic
1100210025 12:92390489-92390511 AAATAACAGAGGAAGCAGAATGG + Intergenic
1102503051 12:113365988-113366010 AAATGCTAGTGGCAGCAGAGGGG - Intronic
1103803265 12:123553357-123553379 AAATACCAGAGGAAGCAGAGTGG + Intergenic
1104364384 12:128163825-128163847 AAATGACAGCGAAAGCAGAGAGG - Intergenic
1104767331 12:131338733-131338755 AAATACCAGAGTAAGTAGAATGG + Intergenic
1105762717 13:23528727-23528749 AAATACCAGAAGAAGCAGGATGG + Intergenic
1105766472 13:23565055-23565077 AAATACTAGGGGAAGCTGAGTGG + Intergenic
1105777371 13:23676354-23676376 AAAAGCCTGAGGAGGCAGAGAGG - Intergenic
1106162932 13:27216605-27216627 AAATACCAGAGGAAGCAGAATGG + Intergenic
1106511330 13:30415289-30415311 GACTACCAGAGGAAGAAGAAAGG - Intergenic
1106985628 13:35345392-35345414 AAATACCAAGTGCAGCAGAGTGG + Intronic
1108848833 13:54704130-54704152 AAATACCAGAGGAAGCAGAATGG + Intergenic
1108876836 13:55058535-55058557 AAATACCAGAGGAAGCAGAGTGG + Intergenic
1109257121 13:60097082-60097104 ATAAACCAGAGGAAGCAGCTGGG - Intronic
1109424678 13:62154145-62154167 AAATACCAGAGGAAGCAGAATGG + Intergenic
1109896177 13:68694286-68694308 AAATACCAAAAGAAGAAAAGAGG - Intergenic
1110182372 13:72633123-72633145 AACTACTAGAGGAAGGAGAGAGG + Intergenic
1110822890 13:79936843-79936865 GCATACCACAGGAAACAGAGTGG - Intergenic
1111195395 13:84869789-84869811 AAATACCAGAGCATGGAAAGTGG + Intergenic
1111547577 13:89762497-89762519 AAATAAATGAGAAAGCAGAGTGG - Intergenic
1112374535 13:98826372-98826394 ATCTCCCAGAGGAAGGAGAGGGG - Intronic
1112538612 13:100284681-100284703 AAGTACCAGAGGAAGCAGAATGG + Intronic
1113203701 13:107893424-107893446 AAATACCAGAGGAAGCAGGATGG - Intergenic
1113887613 13:113669266-113669288 AAAGACAAAATGAAGCAGAGTGG + Intronic
1114287984 14:21263514-21263536 AAATACACGAGGAAGTAGAGAGG + Intronic
1114384471 14:22241178-22241200 AAATACCAGAGGAAGCAGAGTGG + Intergenic
1115181042 14:30626100-30626122 AAATAACACAGGAAGCACGGAGG - Intronic
1115285230 14:31708053-31708075 AAATACCAGAGGAAGCAGAATGG - Intronic
1115528598 14:34305426-34305448 AGACACAAGAGGAAGAAGAGAGG + Intronic
1116299829 14:43164452-43164474 AAAAACATGAGGAAGCAAAGGGG - Intergenic
1116574357 14:46553565-46553587 AACTACCAGAGGGAGTAGTGAGG - Intergenic
1117672595 14:58123598-58123620 AAATACCAGAGGAAGCAGTGTGG + Intronic
1118381971 14:65224900-65224922 AAAACCCACAGGAAGCAGACAGG + Intergenic
1118929215 14:70224534-70224556 AAATAAAAGAGGAGGCAGCGAGG - Intergenic
1119665189 14:76480361-76480383 AAACACCTGGGGCAGCAGAGGGG + Intronic
1120875524 14:89371717-89371739 AGGCACCAGAGCAAGCAGAGAGG + Intronic
1120894334 14:89516276-89516298 AAGTAACTGAGAAAGCAGAGAGG - Intronic
1121164430 14:91778168-91778190 AAATCCCAGAGAATGCGGAGAGG + Intronic
1121518349 14:94568884-94568906 AAAAAATAGAGGAAACAGAGAGG + Intronic
1121781917 14:96627560-96627582 GGAGACAAGAGGAAGCAGAGAGG + Intergenic
1122600322 14:102918100-102918122 AAATACCAGGCCAAGCAAAGGGG + Intergenic
1123031554 14:105454165-105454187 AAACACCACAGGAGACAGAGAGG - Intronic
1123487779 15:20756308-20756330 AAAGACCAGCGGAGGCAGAAGGG + Intergenic
1123544278 15:21325386-21325408 AAAGACCAGCGGAGGCAGAAGGG + Intergenic
1124463699 15:29917537-29917559 AAATAGCAGAGGCTACAGAGGGG + Intronic
1125525451 15:40371281-40371303 AGACACCAGAGAAAGCAGATTGG - Intergenic
1126071864 15:44872530-44872552 AAATACCAGAGGAAGCAGAATGG - Intergenic
1126086396 15:45014456-45014478 AAAAACCAGAGGAAGCAGAATGG + Intergenic
1126589820 15:50327327-50327349 TAAGACCAGAGGTAGTAGAGAGG - Intronic
1126849817 15:52790114-52790136 AAAAAGCCGAGGACGCAGAGGGG - Intronic
1126853254 15:52812143-52812165 AAATACCTAATGAAGCAAAGAGG - Intergenic
1127074130 15:55309682-55309704 AAATACCAGAGGAAGCAGAGTGG - Intronic
1127383625 15:58450151-58450173 AAAGACCAGAAGAGGCAAAGGGG - Intronic
1128305837 15:66598470-66598492 AAAGTTCAGAGGCAGCAGAGTGG - Intronic
1128362457 15:66972029-66972051 AAATACCAGAGGAAGCAGAGTGG - Intergenic
1128441458 15:67713009-67713031 AAAGAACAGAGGAAACAAAGGGG + Intronic
1129114764 15:73359171-73359193 AAATTGCAGAGCAAGCAGCGGGG - Intronic
1129231636 15:74200294-74200316 AAGTGCATGAGGAAGCAGAGAGG + Intronic
1129309576 15:74696552-74696574 AAATGCCAGGGGTAGAAGAGCGG - Intergenic
1129311140 15:74710183-74710205 AAAGACCATATGAAACAGAGAGG - Intergenic
1130812714 15:87397155-87397177 AAATACCAGAAAAAGCAGTAAGG + Intergenic
1130939544 15:88496265-88496287 AATGCCCAGATGAAGCAGAGGGG - Intergenic
1131420339 15:92299662-92299684 AAATATCAGAGGAAGCAGACTGG + Intergenic
1131560989 15:93439422-93439444 AAATACTAGAGGAAGAAAACAGG + Intergenic
1132427614 15:101732015-101732037 AAATCCCAGAGGCAGGAGAGAGG - Intergenic
1132468788 16:90251-90273 AAAGAAGAGAGGAGGCAGAGGGG - Intronic
1133778388 16:8916979-8917001 AAAAAAAAGAGGAAGCAGAATGG + Intronic
1133847519 16:9469162-9469184 AGATACCAGAAGAAGCACAGTGG + Intergenic
1134261950 16:12658354-12658376 AGATACCAGAGGAAGAAGCCTGG - Intergenic
1134378003 16:13696764-13696786 AGATACCAGAGTAGGCACAGAGG + Intergenic
1135339439 16:21633588-21633610 AAATACCAGAGGAGGCAGAATGG - Intronic
1135614533 16:23899466-23899488 ACTTACCAGAGGAAACAGAATGG + Intronic
1136111434 16:28065904-28065926 AAACACCTGAGGATGCACAGAGG + Intergenic
1138084005 16:54117030-54117052 AAAGAGCAGAGGATGCAGAGAGG - Exonic
1138158158 16:54725613-54725635 AGAAACAAGAGGAAGGAGAGAGG - Intergenic
1138624998 16:58244516-58244538 AAAATCCAGAGGCAACAGAGTGG - Intronic
1139163525 16:64539341-64539363 AAATAAAAAATGAAGCAGAGTGG + Intergenic
1139532496 16:67549321-67549343 GAATACATGAGGAAGAAGAGTGG - Intergenic
1139610745 16:68055875-68055897 ACATACCAGAGGACGGAGTGAGG + Intronic
1140271349 16:73469090-73469112 AAATGCAGGAGGATGCAGAGTGG + Intergenic
1140419544 16:74807327-74807349 AAAGACCAGAGGACAGAGAGAGG - Intergenic
1140524930 16:75614760-75614782 AAATACCAAGGGAGCCAGAGAGG + Intronic
1141002050 16:80317489-80317511 AAACACAAGAGGAGGAAGAGAGG - Intergenic
1141213425 16:82001915-82001937 AAAAACCACAGGAAGCACACAGG + Intronic
1141766821 16:86064355-86064377 AAGTTCCAGAGCAAGGAGAGAGG - Intergenic
1143497007 17:7318167-7318189 TGATACCTGAGGGAGCAGAGGGG + Exonic
1145804326 17:27715672-27715694 AAATACCAGAGGAAGCAGAATGG + Intergenic
1146661158 17:34665983-34666005 AAAGGAGAGAGGAAGCAGAGCGG + Intergenic
1146923820 17:36730703-36730725 AAATGCCAGAGGAAGAAGACAGG + Intergenic
1148324744 17:46776769-46776791 AAACACCAGAGGAAGGAGCGGGG - Intronic
1148407054 17:47424459-47424481 AAATAGCAGAGGAACCTGATTGG + Intronic
1149074121 17:52577070-52577092 AAATACTGGAGGAAGCAGAATGG + Intergenic
1149209925 17:54290379-54290401 AAATACCAGAGGAAGCAGAATGG + Intergenic
1149213468 17:54329039-54329061 AAATCCCAGAGGAAGCAGAATGG + Intergenic
1149273923 17:55013931-55013953 AAATACCAGAGGAAGCAGAGTGG - Intronic
1150228935 17:63539333-63539355 GCAGTCCAGAGGAAGCAGAGGGG - Intronic
1151568250 17:74912243-74912265 AAATACCAGAGGAAGCAGAATGG + Intergenic
1152249726 17:79205648-79205670 AAAAACCAGATGAATCAGAGTGG + Intronic
1152827821 17:82478748-82478770 GAAGACCAGAGGAAGCAGTAAGG + Intronic
1153401710 18:4689507-4689529 AAATACCAGAGGACGCAGAGTGG + Intergenic
1153549117 18:6242286-6242308 AAATGACAGAGGAAGCAGTGTGG - Intronic
1153804413 18:8699878-8699900 GAGAACCAGAGGAAGTAGAGAGG - Intergenic
1154456123 18:14527638-14527660 ATAAAGCAGAGGAAGAAGAGAGG - Intronic
1155178739 18:23324725-23324747 AATTACCAGGGGAGGAAGAGTGG + Intronic
1155475894 18:26235762-26235784 AAATACCAGAAGAAGCAGAATGG - Intronic
1155503983 18:26515277-26515299 AAGGTCCAGAGGAAGCAGAAGGG + Intronic
1156212677 18:34963650-34963672 AAAATCCAGAGGAAGAACAGAGG + Intergenic
1156312331 18:35935980-35936002 AAATACCACAGCAAGGGGAGTGG - Intergenic
1156529103 18:37797749-37797771 TAATCCCAGATGGAGCAGAGTGG - Intergenic
1156557669 18:38085851-38085873 AGATACCTGGGGAAGAAGAGGGG + Intergenic
1157751485 18:50182688-50182710 AAGTGCCAGAGGAAACAGATGGG + Intronic
1158175084 18:54646699-54646721 AAGTACCAGAGAAAACACAGAGG - Intergenic
1158785847 18:60711179-60711201 AAATACCAGAGGAAGCAGAGTGG + Intergenic
1159128222 18:64249601-64249623 AAACACCAGAGGAAGAATCGTGG - Intergenic
1159201259 18:65188066-65188088 AAATAAAAGAGAAAGTAGAGGGG - Intergenic
1160381120 18:78456929-78456951 AAATACTAAATGAAGGAGAGAGG - Intergenic
1160736595 19:665436-665458 AAAAAGCAGGGGAAGGAGAGGGG - Intergenic
1161597996 19:5162047-5162069 GAATACCAGAGGAAGCAGAATGG - Intronic
1161726941 19:5934922-5934944 AAATGCCAGACTAAGCAGAAAGG + Intronic
1162013607 19:7831788-7831810 AAATGCCAGAGCCAGCAGGGCGG + Intronic
1162108131 19:8383349-8383371 AAATACCAGAGGAAGCAGAATGG + Intronic
1162124958 19:8494443-8494465 AAAGCCCAGGAGAAGCAGAGGGG + Intronic
1162825422 19:13248426-13248448 AAAAAAAAGAGAAAGCAGAGGGG + Intronic
1163375314 19:16926798-16926820 AGATAGGAGAAGAAGCAGAGAGG - Intronic
1163519453 19:17783242-17783264 AAAAATCCCAGGAAGCAGAGAGG - Intronic
1163661615 19:18581326-18581348 AAATACCAGAAGAAGCAGAGTGG + Intronic
1163691976 19:18743168-18743190 GGGAACCAGAGGAAGCAGAGTGG + Intronic
1164169316 19:22710688-22710710 AAGTAACAGAGGAATCAGAGAGG - Intergenic
1164945342 19:32288558-32288580 GAAAAACAGAGGAAGCAGGGTGG - Intergenic
1165788733 19:38478047-38478069 AAATACCAGGGCAGGAAGAGAGG - Intronic
1165847308 19:38826598-38826620 AAATAACAGAGGCAGCAGAATGG + Intronic
1166382068 19:42360329-42360351 AAAAAACAGCAGAAGCAGAGAGG - Intronic
1166956213 19:46466722-46466744 AAATACGAGAGAAAAGAGAGTGG - Exonic
1168488253 19:56783664-56783686 GAATACAAGAGGAGGCAGGGAGG + Intronic
924973975 2:156484-156506 AAATACCAAAGGAAGCAGAGTGG - Intergenic
925949674 2:8898824-8898846 AAATACCAGAGGAAGCAGAATGG - Intronic
926864631 2:17343721-17343743 AAATACCAGAGGAAGCAGAGTGG + Intergenic
926921497 2:17945006-17945028 ATAAACCAGAGGTAGCAGTGTGG - Intronic
928024555 2:27728908-27728930 CAATAGCAGAGGAGGCACAGAGG - Intergenic
928348008 2:30518698-30518720 AAATACCAGAGGAAGCAGAATGG + Intronic
928595822 2:32857875-32857897 AATTAACACAGGAAACAGAGAGG - Intergenic
928617394 2:33054103-33054125 AAATACCAGAGGAAACAGAATGG - Intronic
928677208 2:33661622-33661644 AAATACCAGAGGAAGCACAGTGG + Intergenic
929042879 2:37762627-37762649 GAAAAGCAGAGGAACCAGAGTGG + Intergenic
929179023 2:39013093-39013115 GAATCAGAGAGGAAGCAGAGTGG - Intronic
929627656 2:43426539-43426561 AAATGCCAGATGAAGGAGACTGG + Intronic
930038754 2:47104474-47104496 ATATACCAGAGGAAGCAGAATGG + Intronic
930408441 2:50992673-50992695 AAATACAAAAGGAATCGGAGAGG - Intronic
930430898 2:51274812-51274834 AAATACCAGAGGAAGTTAGGAGG + Intergenic
930836947 2:55804217-55804239 AAGTAACAAAGGAAGCATAGTGG + Intergenic
931865843 2:66410288-66410310 ATAAACGAAAGGAAGCAGAGAGG + Intergenic
932352159 2:71041468-71041490 AAAAACCAGGGGGAGAAGAGGGG - Intergenic
932608692 2:73182421-73182443 AAATACAAGAAGTAGCCGAGCGG + Intergenic
933175091 2:79165679-79165701 AAATACCAGAGGAAGCAGAGTGG - Intergenic
933270614 2:80229086-80229108 AATTACCTGAGGAATCAGATGGG + Intronic
934475307 2:94589510-94589532 AAAAAACAGAGCAAGGAGAGGGG - Intronic
934622784 2:95825803-95825825 AGATCCCAGAGGAAGGAGTGGGG - Intergenic
934671640 2:96217522-96217544 AAATTCAGCAGGAAGCAGAGCGG - Intergenic
934810990 2:97276300-97276322 AGATCCCAGAGGAAGGAGTGGGG + Intergenic
934826702 2:97431639-97431661 AGATCCCAGAGGAAGGAGTGGGG - Intergenic
934867350 2:97824982-97825004 AAATACCAGAGAAAGCAGAATGG + Intronic
935748851 2:106212812-106212834 AAATACCAGAGGAAGCAGAGTGG + Intergenic
936022562 2:109005958-109005980 AAAGAGGAGAGGAAGCACAGAGG + Intergenic
936802284 2:116283853-116283875 AAATACCAGAGGAAGCAGAGTGG + Intergenic
936985116 2:118301920-118301942 AAATCTCATAGGAGGCAGAGAGG - Intergenic
938375900 2:130806458-130806480 GGAAGCCAGAGGAAGCAGAGGGG + Intergenic
938805969 2:134807532-134807554 AAATAGCAGAGGAGGCAAAATGG - Intergenic
938925610 2:136038809-136038831 TAATAACAGAGAAAGCAGAAAGG - Intergenic
939493486 2:142902977-142902999 AAATACCAGAGGAAGCAGAGTGG - Intronic
939852076 2:147315258-147315280 AAGTACCAGAGGAAGCAGAATGG + Intergenic
939863308 2:147444513-147444535 GAAGACAAGAGGAAACAGAGAGG + Intergenic
940422878 2:153499656-153499678 AAATTCCAGAGGGGGCTGAGGGG + Intergenic
940582775 2:155601817-155601839 ACATACCAGAGGAAGCACAATGG + Intergenic
940986335 2:160055822-160055844 AAATACTAGAAGCAGTAGAGGGG + Intronic
941342150 2:164320106-164320128 AAATCCCAGAAGAAGGAGAGAGG - Intergenic
941446356 2:165605079-165605101 GAACAAGAGAGGAAGCAGAGAGG - Intronic
941546745 2:166860363-166860385 AGTTACCAGAGGTTGCAGAGTGG + Intergenic
942831045 2:180237729-180237751 AAATACGAGAGGAAGCAGAGTGG + Intergenic
943133974 2:183889321-183889343 AAATACCAGAGGAAACAGAATGG + Intergenic
944729225 2:202500793-202500815 AAATACCAGAGGAAGCAGAATGG + Intronic
945028263 2:205639936-205639958 AAGTGGCAGAGTAAGCAGAGAGG + Intergenic
945463879 2:210144735-210144757 AACTACCAGAGAACACAGAGGGG - Intronic
946207147 2:218118056-218118078 AAATACCAGAGGAAGCAGAATGG - Intergenic
946736138 2:222756503-222756525 ATATGCCAGATGAAGGAGAGGGG - Intergenic
948078635 2:235187497-235187519 AAATACCAGAGAAAGGAATGGGG + Intergenic
948870578 2:240795886-240795908 AAAGACCACCAGAAGCAGAGTGG - Intronic
1168741236 20:193219-193241 AAACACCAGAGGAAGCAGAGTGG - Intergenic
1169766039 20:9149133-9149155 AGATACCAAAGAAAGCAGAGAGG - Intronic
1170477262 20:16728246-16728268 AAATACCACAAGAAACACAGAGG - Intergenic
1171953456 20:31441371-31441393 AAATAGAAAAGGAAGGAGAGGGG + Intronic
1172092166 20:32440970-32440992 AGAGACAAGAGGAAGCATAGGGG - Intergenic
1172345368 20:34194105-34194127 ATATACCAGTGGCAGCAGAGAGG + Intergenic
1172825188 20:37776701-37776723 AAATAGCAGAGCATGCAGCGGGG + Intronic
1174298176 20:49563441-49563463 AAACAGCAGAGGAAGTACAGTGG + Intronic
1174535033 20:51244902-51244924 AAATATCAAAGGATTCAGAGAGG - Intergenic
1174902279 20:54512832-54512854 AAAGAGTAAAGGAAGCAGAGAGG + Intronic
1175030521 20:55949368-55949390 AAATACCACAGAAATCAGTGTGG - Intergenic
1175297158 20:57916303-57916325 TTATGCAAGAGGAAGCAGAGTGG - Intergenic
1175433495 20:58925706-58925728 AAATCCCAGATGAAGCATGGTGG + Intergenic
1176818040 21:13625698-13625720 ATAAAGCAGAGGAAGAAGAGAGG + Intronic
1176828730 21:13723319-13723341 AAAGACCAGCGGAGGCAGAAGGG - Intergenic
1177135282 21:17300654-17300676 AAATACCAGAGTCAGCAGAATGG + Intergenic
1177263349 21:18755707-18755729 AAATACTAGAGGAAGCAGAGTGG - Intergenic
1177896421 21:26859538-26859560 AAATACCACAGGAAGCAGAGGGG + Intergenic
1179053324 21:37908183-37908205 AAGAACCAGAAGAAACAGAGTGG - Intronic
1179258969 21:39741794-39741816 AAATACCAGAGGAAGCAGAGTGG - Intergenic
1179772671 21:43634521-43634543 AAATACAAGACAAAGTAGAGGGG + Intronic
1182994227 22:34798292-34798314 AGATACAAGAGGAAGAAGTGGGG - Intergenic
1183063014 22:35347037-35347059 AAATTCTAGAGGAAGGGGAGAGG - Exonic
1185033295 22:48457176-48457198 AAGTCCCAGAAGAAGCCGAGAGG + Intergenic
1185221914 22:49633280-49633302 AAAGAGCAGAGGAGGCAGGGAGG - Intronic
1185235494 22:49710407-49710429 AATGACCAGAGGAAGAAGAAAGG + Intergenic
1203295065 22_KI270736v1_random:34123-34145 GAAAAGCAGAGGAACCAGAGTGG + Intergenic
949826974 3:8175916-8175938 AAATATCAAAGGATGCAGTGTGG - Intergenic
950933286 3:16812197-16812219 AAAAACCAGAGGAGGCTGAATGG - Intronic
951006772 3:17626155-17626177 AAATACCAATGACAGCAGAGGGG + Intronic
951020704 3:17778324-17778346 AAATACCAGAAGAAGCAGAATGG + Intronic
951021643 3:17787305-17787327 GACTACCAGAGGAGGAAGAGAGG - Intronic
951200527 3:19871944-19871966 AAATACCAGAGGAAGCAGAGTGG - Intergenic
951665625 3:25120169-25120191 AATTACCACAGGAACCAGATAGG + Intergenic
951838083 3:27004049-27004071 AAATACCAGAGGAAGCAGAGTGG + Intergenic
951924498 3:27892931-27892953 GAATCCCAGAGAAAGAAGAGGGG + Intergenic
951924558 3:27893970-27893992 AAGTACCAGAGTCAGCAGAGTGG + Intergenic
952453249 3:33450525-33450547 AAATACCAGAGGAAGCAGAATGG + Intergenic
952922062 3:38292378-38292400 AAATACCAGAGGAAGCAGAGTGG - Intronic
952940739 3:38442556-38442578 AAATACCAGAGGAAGCAGAATGG - Intergenic
953622718 3:44547041-44547063 AAATACCAGAGGAAGCAGAATGG - Intergenic
953700734 3:45193715-45193737 AAATCCCAGGGGTAGAAGAGAGG + Intergenic
954068579 3:48126401-48126423 AAAAAAAAGAAGAAGCAGAGAGG - Intergenic
954220651 3:49151689-49151711 GAATACCTGAGGGAGCACAGAGG + Intergenic
954494923 3:50948633-50948655 AAATAAAAGAGGAAACAAAGAGG - Intronic
954587203 3:51746209-51746231 AAATACCATGGGAGGCAGAAGGG + Intergenic
954917928 3:54164495-54164517 AGATATCAGAGGAAACACAGGGG - Intronic
955878844 3:63522751-63522773 AAACAGCAGAGGGAGCATAGCGG + Intronic
956800987 3:72758170-72758192 AAATACCAATGGATGCACAGAGG + Intronic
957000119 3:74875352-74875374 AAAAACCTGAGGAAGCAAAGTGG - Intergenic
957383223 3:79461428-79461450 AAATACAGGAAGAAGGAGAGGGG + Intronic
957716473 3:83935287-83935309 AAATAAAAAGGGAAGCAGAGTGG + Intergenic
957718182 3:83960416-83960438 GAATACTAGAGGAGGGAGAGAGG - Intergenic
957861300 3:85954918-85954940 AAATATCACAGGAAATAGAGAGG + Intronic
958016079 3:87941755-87941777 AAATAGCAGAGGAAGCAGAGTGG - Intergenic
958549017 3:95591602-95591624 AAATACCAGAGGAAGCAAAATGG - Intergenic
958629638 3:96669796-96669818 AAATACCATAGGAAGCAGAGTGG - Intergenic
958795304 3:98700768-98700790 AAATACAAGAGGAAGCAGAAGGG + Intergenic
959269126 3:104183194-104183216 AAATAAGAGAGGAAGGAGAAAGG + Intergenic
959631701 3:108514378-108514400 AAATACCTGAGGAGGGAGAGGGG - Intronic
960277635 3:115745540-115745562 AAATACCAGAAGAAGCAGAATGG + Intergenic
960539405 3:118847190-118847212 AGATACCAGAGGAAGCAGAATGG + Intergenic
962458931 3:135591236-135591258 AAAAGCCAGTTGAAGCAGAGAGG - Intergenic
962495619 3:135936365-135936387 AAATACCAGAGGAAGCAGAGTGG + Intergenic
963031445 3:140982286-140982308 GAGTTCCAGAGTAAGCAGAGAGG + Intergenic
963188120 3:142440746-142440768 AAATACCAGAGGAAGCAGAGCGG + Intronic
963296304 3:143550313-143550335 AAATGCAAGTGGAGGCAGAGAGG - Intronic
963373310 3:144430107-144430129 AACCACCCTAGGAAGCAGAGTGG - Intergenic
963696963 3:148574713-148574735 AAATACCAGAGGAAGCAGAATGG + Intergenic
963915932 3:150858806-150858828 AAATACCAGAGGAAGCAGAGTGG + Intergenic
963992080 3:151667056-151667078 AAATACCAGAGGAAGCAGAATGG - Intergenic
964064718 3:152563709-152563731 AAATACCAGAGGAAGCAGAATGG + Intergenic
964705097 3:159609861-159609883 GAAAACCACAGCAAGCAGAGAGG + Intronic
964916758 3:161849799-161849821 AGATACCAGAGGAAGCAGAATGG - Intergenic
964953585 3:162325824-162325846 AAATACCAGAGGAAGCAGAGTGG + Intergenic
965054633 3:163697442-163697464 AAATGCCAGAGGAGGCAGAGTGG - Intergenic
965056013 3:163717523-163717545 AAATACCAGAAGGAGGAGAGAGG + Intergenic
965062950 3:163805454-163805476 AAATACCAGAGGAAGCAGAATGG + Intergenic
965139409 3:164815370-164815392 AAATACCAGAGGAAGCAGAATGG + Intergenic
965410605 3:168326053-168326075 GAGAAACAGAGGAAGCAGAGTGG + Intergenic
965786042 3:172336150-172336172 AAATACCAGGTGAAGGAGAGGGG + Intronic
966353671 3:179057302-179057324 AAATACCAGAGGAAGCAGAGTGG + Intronic
966903271 3:184502837-184502859 AAAATCCAGAGGAGACAGAGGGG + Intronic
966903310 3:184503077-184503099 AAAATCCAGAGGAGGTAGAGAGG + Intronic
966903323 3:184503137-184503159 GAAATCCAGAGGAGGCAGAGGGG + Intronic
967572921 3:191052187-191052209 AAATACCTTCGGAAGCAGAGTGG - Intergenic
967583875 3:191189646-191189668 AAATACCAGAGGAAGCAGAATGG + Intergenic
967623716 3:191663045-191663067 AAATACCAGAGGCAGCAAAGTGG + Intergenic
968708616 4:2096014-2096036 AATTTCCAGAGGAAGCACAGTGG - Intronic
969645125 4:8423686-8423708 AAATACCAGAGGAAGCAGAGTGG + Intronic
971280987 4:25242496-25242518 AAATACCGGAGGAAGCAGAATGG - Intronic
971578673 4:28306905-28306927 AAATACCAGAGTAAGCAGAATGG + Intergenic
971587662 4:28424938-28424960 GACTACTAGAGGAAGAAGAGGGG + Intergenic
972133086 4:35861280-35861302 AAATACCAGAGGAAGCAGAATGG - Intergenic
972144441 4:36004191-36004213 AACTTCCAGAAGAAGCATAGTGG + Intronic
972658560 4:41091121-41091143 AAATACCAAAGCAAGGGGAGAGG - Intronic
972781197 4:42288323-42288345 AAATACCAGAAGAAGCAGAGTGG - Intergenic
973046060 4:45535320-45535342 AAATACCAGAGGAAGCAGAATGG + Intergenic
973850184 4:54954395-54954417 CAACACCAGAGGAGGAAGAGGGG + Intergenic
974174713 4:58308240-58308262 AAATACCAGAGGAAGCAGAATGG + Intergenic
974187529 4:58461976-58461998 AAATACCAGAGGAAGGAGAATGG + Intergenic
974520634 4:62976480-62976502 AAATACCAGAGGAAGGAGTGTGG + Intergenic
974526760 4:63056734-63056756 AAATACCAGACGAAGCAGAATGG + Intergenic
974537333 4:63188521-63188543 AAATACCAGAGGAAGCAGAATGG + Intergenic
974543056 4:63264542-63264564 TAATAACAGAGGAAACAGTGTGG - Intergenic
974838645 4:67278416-67278438 AAATACCAGAGGAAGCAGAATGG - Intergenic
975223544 4:71842111-71842133 AAAGAACAGAGAAAGCAGAGTGG - Intergenic
975249223 4:72158127-72158149 AGATACCAGAGCAGGAAGAGAGG + Intergenic
975313645 4:72929062-72929084 AAATACCAGAGGAAGCAGAGTGG - Intergenic
975411915 4:74062772-74062794 TAATACCAGAGGAAGAAAAATGG - Intergenic
975595614 4:76046297-76046319 AAATACCAGGGGAAGCAGAATGG - Intronic
976216095 4:82716839-82716861 AAATACTTGAGGAAGCAAAATGG + Intronic
976814212 4:89128063-89128085 AAAGACCAGAGATAACAGAGGGG - Intergenic
977255363 4:94734275-94734297 GAATAACAGAAGCAGCAGAGAGG - Intergenic
977460723 4:97321522-97321544 AAATAACACTGGAAACAGAGAGG - Intronic
977834724 4:101634395-101634417 AAATACCAGAGGAAGCAGAATGG - Intronic
977884290 4:102239188-102239210 AAATACAAGAGGAAGCAGAATGG + Intergenic
977979723 4:103307512-103307534 AGCTACCAGAGGCAGCAGACAGG - Intergenic
978586631 4:110281722-110281744 AAATACCAGAGGAAGCAGAATGG - Intergenic
978767894 4:112423181-112423203 AAAGACCTGAAGAAGAAGAGAGG + Intronic
978909729 4:114049281-114049303 AAATACCAGAGGAAGCAGAGCGG + Intergenic
978914452 4:114106719-114106741 AAAGACTAGAAGAAGCAGAAAGG + Intergenic
980195674 4:129585111-129585133 AAATACCAGAAGAAAAAGAAAGG + Intergenic
980290696 4:130845342-130845364 AAATACCAGAGGAAGCAGAATGG - Intergenic
980444379 4:132886598-132886620 AAATACCAGAGGAAGCAGAGTGG + Intergenic
980872629 4:138627016-138627038 AAATACCAGAGGAAGCAGAGTGG - Intergenic
982185586 4:152794708-152794730 AATTAACATAGGAAGCAAAGTGG - Intronic
982633589 4:157864441-157864463 AAATATCAGAGGAACAAAAGTGG + Intergenic
982701331 4:158661870-158661892 AAATAACAGAGGAAGCAGAATGG + Intergenic
983062552 4:163175450-163175472 AAATACCTGAGGGAACAGAATGG + Intergenic
983833603 4:172362420-172362442 CAATGCCAAATGAAGCAGAGAGG - Intronic
984183198 4:176510456-176510478 GAGTAGCAGAGGAAGAAGAGAGG - Intergenic
984648134 4:182241427-182241449 AGGATCCAGAGGAAGCAGAGGGG - Intronic
984723909 4:183001861-183001883 AAATACCAGAGGAAGCAGAGTGG + Intergenic
984917655 4:184738326-184738348 AAATACCAGAGGAAGCAGAATGG + Intergenic
985832745 5:2247471-2247493 AAATATAAGATGAAGAAGAGAGG - Intergenic
985843152 5:2324684-2324706 AAATACCAGAGAAATCAGAGAGG + Intergenic
986787956 5:11132299-11132321 AAAGACCATAAAAAGCAGAGAGG - Intronic
986944457 5:12998924-12998946 CAGTGCCAGAGAAAGCAGAGAGG - Intergenic
987087965 5:14487481-14487503 GAGTACCAGAGGAACCACAGCGG + Exonic
987462448 5:18228943-18228965 AAAGAAAAGAGGAAGCAAAGAGG + Intergenic
987545040 5:19303456-19303478 AAATACCAGAGGAAGCAGAGTGG - Intergenic
987715985 5:21571631-21571653 AAATGCAAGAGGAAGCAGCAAGG + Intergenic
987818074 5:22930002-22930024 AAATATCAGAGGAAGAAGAATGG + Intergenic
987930093 5:24391046-24391068 AAATACCAGAGGAAGCAGAATGG + Intergenic
988357995 5:30201495-30201517 AAATACCAGAGGAAGCAGAATGG + Intergenic
988591804 5:32555972-32555994 AAATACCAGAGGAAGCAAAATGG - Intronic
989496377 5:42114749-42114771 AAATACCAGAGAAAGTAGAATGG + Intergenic
989957543 5:50374225-50374247 AAATACCAGAGGAAGCAGAATGG + Intergenic
990167290 5:53008806-53008828 AAATACCAGACCTGGCAGAGTGG - Intronic
990187431 5:53223332-53223354 AAATACCAGAAGAAGCAGAGTGG - Intergenic
990892451 5:60663485-60663507 AAATACCAGAGAAAGCAGAGTGG + Intronic
991608830 5:68429564-68429586 AAACTCAAGAGGAAACAGAGAGG + Intergenic
992049572 5:72930199-72930221 AAATACCAGAGGAAGCAGAATGG + Intergenic
992455402 5:76911388-76911410 AAACACCAGAGGAAGCAGAATGG + Intronic
993027101 5:82660003-82660025 CAAAAGCTGAGGAAGCAGAGTGG - Intergenic
993057447 5:82998291-82998313 AAATGCCAAAAGAAGCAGAGAGG - Intergenic
993356831 5:86923688-86923710 AATCTCCAGAGGAAGAAGAGAGG - Intergenic
994356908 5:98803080-98803102 AAATATCTGAGGGAGGAGAGTGG - Intergenic
994454225 5:99984514-99984536 AAATACCAGAGGAAGCAGAATGG + Intergenic
995501077 5:112807660-112807682 AAAAACCAGTGGCAGTAGAGTGG - Intronic
995583216 5:113621916-113621938 AAATACCAGAGGAACCAGAATGG - Intergenic
995706630 5:114994274-114994296 AAATACCAGAGGAAGCAGAATGG + Intergenic
996038172 5:118781756-118781778 AAATACCAGAGAATATAGAGTGG - Intergenic
996680413 5:126224059-126224081 AAATGCCAGAGGAAGCAGAATGG + Intergenic
996838967 5:127825469-127825491 AAATTCCTGATGGAGCAGAGTGG - Intergenic
997137492 5:131342298-131342320 AAATACCAGAAGAAGCAGCTTGG + Intronic
997191833 5:131945191-131945213 AGATTGCAGAGAAAGCAGAGCGG - Intronic
997368298 5:133339742-133339764 AAGTTCCAGAGGAAGCAAAAGGG - Intronic
998528190 5:142861453-142861475 TAATACCACAGGAAGCAAGGTGG - Intronic
998725508 5:145008636-145008658 GGATACCAGTGGAAGCAGATTGG - Intergenic
999629765 5:153558887-153558909 ACAAACCAGAGGAAGCAGCAAGG - Intronic
1000085427 5:157883910-157883932 AAATACCAGAGGAAGCAGAATGG + Intergenic
1001051274 5:168416401-168416423 AAATCCCAGAGAAAGCAGAATGG - Intronic
1002164220 5:177334583-177334605 AAAAAAGAGAGGAGGCAGAGTGG + Intronic
1002370922 5:178753700-178753722 AAATAACAGTGGAAAAAGAGGGG + Intergenic
1002705382 5:181157808-181157830 AAATCCCAGAGAAATCTGAGTGG - Intergenic
1002796939 6:479556-479578 AAATACCCCAGGAATCAAAGAGG - Intergenic
1003060424 6:2858313-2858335 AAAAAGTACAGGAAGCAGAGAGG - Intergenic
1004531571 6:16459570-16459592 AAATACCAAAGGAAGCAGAATGG + Intronic
1004812442 6:19275110-19275132 AAATACCAGAGGAAGCAGAATGG + Intergenic
1005323499 6:24678265-24678287 AAAAACCACAGAAAGCAGAGTGG - Intronic
1005427250 6:25715788-25715810 ATATATGAGTGGAAGCAGAGAGG + Intergenic
1006210598 6:32390518-32390540 AAAAGCCACAGGAAGGAGAGGGG - Intergenic
1007030234 6:38620292-38620314 AAATACCAGAGGAAGTGGAATGG + Intronic
1007451807 6:41945751-41945773 GGATAAAAGAGGAAGCAGAGAGG - Intronic
1007457548 6:41991755-41991777 AAATACTAGAGGATGGAAAGGGG - Intronic
1008094004 6:47320527-47320549 AACTAACAGGGAAAGCAGAGAGG - Intergenic
1008195592 6:48516199-48516221 GAATAGCACAGGAAGCAGAGTGG - Intergenic
1008354718 6:50538662-50538684 GAATACCAGAGAAAAAAGAGGGG - Intergenic
1008582205 6:52917510-52917532 AAATACCAGAGGAAGCAGAGTGG - Intergenic
1008804049 6:55406031-55406053 AAAGAACAGAGCAAGCAGACAGG - Intergenic
1009000737 6:57710429-57710451 AAATGCAAGAGGAAGCAGCAAGG - Intergenic
1009385750 6:63082910-63082932 AAATACCAGAGGAAGCAGAATGG - Intergenic
1009407514 6:63329344-63329366 AAATACCAGAGGAAGCAGAATGG - Intergenic
1009471002 6:64028516-64028538 AAATACCAGAGGAAGCAGAATGG + Intronic
1009544957 6:65009435-65009457 AAATACCGGAGGAAGCAGAGTGG + Intronic
1009644811 6:66386010-66386032 ACATTCCAGAGAAAGAAGAGGGG - Intergenic
1009810308 6:68653915-68653937 AAATAACAAAGGAGGAAGAGAGG - Intronic
1009872974 6:69472017-69472039 AAATACCAGAGGAAGCAGAATGG + Intergenic
1010270016 6:73907694-73907716 AAATACCAGAGGAAGCATAATGG + Intergenic
1010284059 6:74054766-74054788 AAAGTCCAGAGGCAGCAGACTGG + Intergenic
1010864897 6:80963803-80963825 AAATTCCAAAGGTAGCACAGGGG + Intergenic
1010893627 6:81341653-81341675 AAATACCAGAGGAAGCAGAGTGG + Intergenic
1011076948 6:83447859-83447881 AAATACCAGAGGAAGCAGAGTGG + Intergenic
1011189615 6:84715768-84715790 AAATACCAGAGGAAGCAGACTGG - Intronic
1011374857 6:86677497-86677519 AAATACCAGAGGAAGCAGAATGG - Intergenic
1011402335 6:86977186-86977208 AACTACCAGAGGAGGGAGAGGGG - Intronic
1011539688 6:88416687-88416709 AAATACCAGAGGAAGCAGAGTGG - Intergenic
1012441350 6:99264917-99264939 AAATACCAGAGGAAGCAGAATGG - Intergenic
1012465256 6:99510344-99510366 AATCAACAGAGGAAGAAGAGGGG + Intronic
1013022405 6:106232806-106232828 AAATACCAGAGGAAGCAGAGTGG + Intronic
1013405205 6:109837357-109837379 AAAGACAAGAAGAAGCATAGTGG + Intergenic
1013543716 6:111135524-111135546 AAATACTAGAGGAAGCAAAGTGG + Intronic
1013652844 6:112213343-112213365 AAAAACAAGTGGAAGCAGATAGG - Intronic
1013907654 6:115237259-115237281 AAATACCAGAGGAAGCAGAATGG - Intergenic
1014154701 6:118097033-118097055 AAATAAAAGAGGAAGAAGAGAGG - Intronic
1014202446 6:118621320-118621342 AGATACCAGAGGAAGCAGAACGG + Intronic
1014221829 6:118805717-118805739 AAAACCTAAAGGAAGCAGAGTGG + Intergenic
1014272102 6:119347879-119347901 AAATACAAGAGGCAGCCGACTGG + Intronic
1014346720 6:120279829-120279851 AAGTACCAAAGGAGGCCGAGAGG + Intergenic
1015575823 6:134669993-134670015 AAATAGCAGAGGTGGCAGAATGG - Intergenic
1015865315 6:137721464-137721486 AAATACCAGAGGAAATAGAGTGG - Intergenic
1016343080 6:143083488-143083510 AAATACTAGAGGAAGCAGAGTGG - Intronic
1016444547 6:144118849-144118871 AAATACCAGAGGAAACAGGGTGG - Intergenic
1017019200 6:150126881-150126903 AAACACCAGAGGTAGCTGACTGG - Intergenic
1017101148 6:150850936-150850958 AAATACCAGAGGAAGCAGAATGG + Intergenic
1018761213 6:166895735-166895757 AAATACCAGAGGAAGCAGAGTGG + Intronic
1019873637 7:3790074-3790096 AAATGCCAGGTGTAGCAGAGTGG + Intronic
1019886203 7:3908300-3908322 AAATGCAAGTGGAAGCAGGGAGG + Intronic
1020503990 7:8960304-8960326 AATTACCAAAGAAAACAGAGCGG + Intergenic
1020575156 7:9916951-9916973 TATTACCAGAGGGAGAAGAGTGG - Intergenic
1021717770 7:23474587-23474609 AAAAACGAGAGCGAGCAGAGGGG - Intergenic
1021756532 7:23858211-23858233 AAATACCAGAGGAAGCAGAATGG - Intergenic
1021882433 7:25107686-25107708 AAATAAAAGAAGAAGAAGAGTGG + Intergenic
1022030054 7:26484246-26484268 AAATATCATAGGAATCAGTGAGG - Intergenic
1022948895 7:35316754-35316776 AAACAGCAGAGGAAGCAGGTGGG + Intergenic
1023137024 7:37062966-37062988 ACATTCCAGAGGCATCAGAGAGG + Intronic
1023673857 7:42609258-42609280 CAATGCCAGAAGAAGCAAAGAGG + Intergenic
1023740771 7:43278708-43278730 AAAAAGCACTGGAAGCAGAGGGG - Intronic
1024713885 7:52052227-52052249 GAATACCAGAGGGAAGAGAGAGG - Intergenic
1024870593 7:53958819-53958841 AAATACCAGAGGAAGCAGAATGG - Intergenic
1026032849 7:66809547-66809569 GAATGCCAGAGGAAGCACATAGG - Exonic
1026228809 7:68465752-68465774 AAACCACAGGGGAAGCAGAGTGG + Intergenic
1028495035 7:91452441-91452463 AAATACCAGAGGAAGCAGAATGG - Intergenic
1028588413 7:92473162-92473184 AAATACCAGAGGAAGCAGAGTGG - Intronic
1030337465 7:108341931-108341953 AAATACCATAGGAAGCAGAGTGG + Intronic
1030345002 7:108423209-108423231 AAAGATCAGAGGTAGCTGAGGGG + Intronic
1030843325 7:114381610-114381632 AAATACCAGAGGAAGCAGAGTGG - Intronic
1030977194 7:116141608-116141630 AAAGACCACTGGAAGCACAGAGG + Intronic
1031264722 7:119568299-119568321 AAATACCAGAGGAAGCAGAGTGG + Intergenic
1031731970 7:125311715-125311737 AAATACCAGAGGAAACAGAATGG + Intergenic
1032316419 7:130842662-130842684 AAATACCACAGGAAAAAGTGAGG - Intergenic
1033583492 7:142757182-142757204 AAATCCCCGAGGAAGGAGACAGG - Intronic
1033759046 7:144421031-144421053 AAATACCAGAGGAAGCAGAATGG - Intergenic
1033837423 7:145332205-145332227 ACATACCAGAAGCAGGAGAGAGG - Intergenic
1033933683 7:146556265-146556287 AAACACCACAGGAAGTATAGGGG + Intronic
1034579783 7:152032386-152032408 AAATACCAGAGGAAGCAGAATGG - Intronic
1034745761 7:153522589-153522611 AAATTCCAGAGGGAGGAGTGAGG - Intergenic
1036449494 8:8853349-8853371 AAATAGCAGAGAAAGCGGAAGGG + Intronic
1036477219 8:9104249-9104271 AAATACCAGAAAAGGCAGAAAGG + Intronic
1036776810 8:11618357-11618379 AAATACCAGAAGCAGCAGCTGGG - Intergenic
1037869958 8:22484873-22484895 AAAGATAAGAGGAGGCAGAGCGG + Intronic
1038206550 8:25472082-25472104 GTAAAACAGAGGAAGCAGAGGGG - Intronic
1038215421 8:25557696-25557718 ATAGACCAGAGGAAGAAGGGTGG + Intergenic
1038430592 8:27496500-27496522 AAATACCAGAGGAAGCAGAATGG - Intronic
1038450164 8:27634373-27634395 GAAGACCAGAGGAAGCAAAGAGG + Intronic
1038638980 8:29308861-29308883 AAATACCAGAGGAAGCAGAATGG + Intergenic
1039276187 8:35935880-35935902 AAATACCAGAGAAAGCAGAATGG + Intergenic
1039678119 8:39694689-39694711 AAATAATAGGGGAAGCAGAGAGG - Intronic
1039999494 8:42564263-42564285 AAATACCAGAGGAAGCAGAATGG - Intergenic
1040649150 8:49430218-49430240 AAATACCAGAGGAAGCAGAATGG + Intergenic
1040667683 8:49653122-49653144 AAATACCAGAGGAAGCAGAATGG - Intergenic
1040796641 8:51295383-51295405 AAATACCAGAGGAAGCAAAATGG - Intergenic
1040953594 8:52958544-52958566 AGATACCAGAGGAAGCAGAATGG + Intergenic
1040964872 8:53073203-53073225 AAATACCAAAGGAAGCAGAATGG - Intergenic
1040971272 8:53139688-53139710 AAATACAAGAGGAAGCAGAATGG - Intergenic
1041002104 8:53463474-53463496 AAATACCAGAGGAAGCAGAATGG + Intergenic
1041285036 8:56252157-56252179 AACTTCCAGAGGAAGGAGGGAGG - Intergenic
1041663697 8:60422804-60422826 AAATACCAGAGGAAGCAGAGTGG - Intergenic
1041752511 8:61276344-61276366 AAAAACCAGAACAAGCAAAGGGG - Intronic
1041948842 8:63477263-63477285 AAACACCAGCAGAAGCAGAATGG - Intergenic
1042772100 8:72391840-72391862 AAATACCCGAGGAAGAAGAATGG + Intergenic
1042919802 8:73909893-73909915 AAACACCAGAGGAAGGAGAATGG + Intergenic
1043257245 8:78151460-78151482 AAATACCAGAGGAAGCAGAATGG + Intergenic
1043490135 8:80740642-80740664 AAATACCAGAGGAACCAGAGTGG + Intronic
1044005244 8:86930626-86930648 AAATACCAGAGGAAGCAGAATGG - Intronic
1044456446 8:92396997-92397019 AAATACCAGAAGAAGCAGAATGG - Intergenic
1044638149 8:94349088-94349110 AATTACCAAAGAGAGCAGAGGGG + Intergenic
1045334695 8:101189136-101189158 AAATAGGAGTGGAAGCTGAGGGG - Intronic
1045401570 8:101824255-101824277 AAAGGCCAGTGGAAGCTGAGAGG - Intronic
1045736283 8:105299411-105299433 GAACACCAGAGCTAGCAGAGTGG - Intronic
1045929128 8:107602871-107602893 AGATATCAGAGGAAGCAGAATGG - Intergenic
1046401649 8:113712633-113712655 AACTACCAAAGGGAGCAGAGAGG + Intergenic
1046623068 8:116548265-116548287 AAATACCAAGGGACTCAGAGAGG - Intergenic
1047223612 8:122938534-122938556 AAACAGAAGAGGAAGCTGAGGGG + Intronic
1047540027 8:125755739-125755761 GAATACAAGAGGAAGAAGAAAGG - Intergenic
1047645047 8:126861513-126861535 TCCTGCCAGAGGAAGCAGAGTGG + Intergenic
1047807920 8:128378685-128378707 AGATACCAGAGGAAGCAGAATGG - Intergenic
1047836377 8:128697958-128697980 AGATACCAGATGAAAAAGAGAGG - Intergenic
1047872628 8:129101832-129101854 AAATACTAGAAGAAGAAGATAGG - Intergenic
1048115536 8:131517691-131517713 AAGAAGGAGAGGAAGCAGAGAGG - Intergenic
1048409360 8:134155956-134155978 AAATTCCAGAGGAGAGAGAGAGG - Intergenic
1048468790 8:134688900-134688922 GAAAACCCCAGGAAGCAGAGTGG - Intronic
1048951729 8:139502072-139502094 AGATACCAGATGAAGCCGTGGGG - Intergenic
1049361317 8:142213704-142213726 AATTACCACAGGAAGCAGGGAGG + Intronic
1050458475 9:5856519-5856541 GAGTACCAGAGCCAGCAGAGAGG - Intergenic
1051053917 9:12960631-12960653 AGATACCAGAGGAAGGAGTATGG + Intergenic
1051310663 9:15767660-15767682 AAATACCAAAGGCAGGACAGTGG - Intronic
1051935456 9:22438436-22438458 AACTACCAGAGGAAGCAGAATGG + Intergenic
1052057589 9:23921981-23922003 AAATACCAGAGAAAGCATAGTGG - Intergenic
1052289690 9:26827249-26827271 AAATACCAGAGGACGCAGAATGG + Intergenic
1052662567 9:31454299-31454321 AAAGACCATGGAAAGCAGAGGGG + Intergenic
1052854740 9:33400271-33400293 AAAAAACAGAGCAAGGAGAGGGG + Intronic
1053682760 9:40496552-40496574 AAAAAACAGAGCAAGGAGAGGGG + Intergenic
1054280954 9:63128377-63128399 AAAAAACAGAGCAAGGAGAGGGG - Intergenic
1054295860 9:63332066-63332088 AAAAAACAGAGCAAGGAGAGGGG + Intergenic
1054393877 9:64636561-64636583 AAAAAACAGAGCAAGGAGAGGGG + Intergenic
1054428526 9:65141774-65141796 AAAAAACAGAGCAAGGAGAGGGG + Intergenic
1054501853 9:65879771-65879793 AAAAAACAGAGCAAGGAGAGGGG - Intronic
1055777297 9:79780132-79780154 GAATATCGGAGGAAGCAGAAAGG + Intergenic
1055858587 9:80722287-80722309 AAATACAGAGGGAAGCAGAGAGG - Intergenic
1056392594 9:86153388-86153410 AAATACCAGAGGAAGCAGAATGG - Intergenic
1057181391 9:93032689-93032711 AGATGCCAGAGGAGGTAGAGTGG - Intronic
1059087188 9:111317020-111317042 AACTTCCAGATGCAGCAGAGCGG - Intergenic
1059991085 9:119867417-119867439 AACTACAAGAGGAGGTAGAGAGG + Intergenic
1060254506 9:122015365-122015387 AAATAACACTGGAAGCAGATGGG + Intronic
1060712209 9:125878533-125878555 ATATACAAAAGGCAGCAGAGAGG - Intronic
1062285318 9:135770196-135770218 CCATGCCAGGGGAAGCAGAGGGG + Intronic
1203529319 Un_GL000213v1:123805-123827 ATAAAGCAGAGGAAGAAGAGAGG - Intergenic
1185530711 X:816286-816308 AAATACCAGAGCACAAAGAGCGG + Intergenic
1187310648 X:18137949-18137971 TAACAGCAGGGGAAGCAGAGAGG + Intergenic
1187994526 X:24911566-24911588 AAAAGCCAAAGCAAGCAGAGGGG + Intronic
1188097713 X:26044008-26044030 AAATACCAGAGGAAGCAGAATGG + Intergenic
1188136703 X:26501361-26501383 AAATACTAGAAGAAGCAAAATGG + Intergenic
1189895527 X:45651644-45651666 AAGAACCAGAGGAAGCAGTCGGG - Intergenic
1190158099 X:48009826-48009848 AAATACCAGATCACTCAGAGTGG + Intronic
1190173870 X:48132710-48132732 AAATACCAGATCACTCAGAGTGG + Intergenic
1190732296 X:53234132-53234154 AAAAAACCGAGGAAGCAAAGAGG + Exonic
1190809463 X:53869412-53869434 TAATACCACTGGGAGCAGAGAGG - Intergenic
1191166924 X:57401432-57401454 AAATGTCAGAGGAAGCAGAGTGG - Intronic
1191661589 X:63657151-63657173 AAAGAGCAGATAAAGCAGAGAGG - Intronic
1192482569 X:71498317-71498339 AAATACCAGAGGAAGCAGAATGG - Intronic
1192939806 X:75900802-75900824 AAATACCAGAGGAAGCAGAGTGG - Intergenic
1193306863 X:79960558-79960580 AAATACCAGAGGAAGCAGAGTGG + Intergenic
1193713780 X:84911246-84911268 AAATATCAGTGAAAGCATAGTGG - Intergenic
1195232123 X:102860277-102860299 AAATTCCAGAGGGATCATAGTGG - Intergenic
1195439755 X:104886645-104886667 AAATACCAGAGGAAGCAGAATGG + Intronic
1195535119 X:106001582-106001604 AAATACCAGAGGAAGCAGAGTGG + Intergenic
1195582981 X:106529408-106529430 AAATAACAAAGGAAGCACATAGG - Intergenic
1195713825 X:107798324-107798346 AAACAGCAGAGGAAACAGAAGGG - Intergenic
1195760494 X:108240809-108240831 AAATATTGGAGGAAACAGAGGGG + Intronic
1196127169 X:112112904-112112926 AAATACCAGAGAAAGCAGAATGG - Intergenic
1196527179 X:116740421-116740443 AAATACCAAAGGAAGCAGAGTGG - Intergenic
1196527355 X:116741577-116741599 AAATACCAGAGGAAGCAGAGTGG + Intergenic
1197391335 X:125869469-125869491 AAACAGCAGAGTAATCAGAGAGG - Intergenic
1197513593 X:127398905-127398927 AAATACCAGAGGAAGCAGAATGG + Intergenic
1197542861 X:127788161-127788183 CAATACTGTAGGAAGCAGAGTGG - Intergenic
1197977753 X:132183288-132183310 AGATACTAAAGGCAGCAGAGTGG - Intergenic
1199832220 X:151558325-151558347 AAATACCAGAGGAAGCAGAATGG - Intergenic
1200800841 Y:7385999-7386021 AAATACCAGAGGAAACAGAATGG - Intergenic
1200880634 Y:8208512-8208534 AAATACCAGAGGAAGCAGAATGG - Intergenic
1201311882 Y:12604830-12604852 AAATACCAGAGGAAGCAGAATGG - Intergenic
1201403933 Y:13631694-13631716 AAATACCAGAGGAAGAAGAATGG + Intergenic
1201407351 Y:13662470-13662492 AAATTCCAGAGGAAGCAGAATGG - Intergenic
1201429864 Y:13892817-13892839 AAATACCAGAGGAAGCAGAATGG + Intergenic
1201455296 Y:14162125-14162147 AAATATCAGAGGAAGCAGAATGG + Intergenic
1201487753 Y:14510210-14510232 AAATACCAGCAGAAGCAGAATGG + Intergenic
1201530718 Y:14987346-14987368 AAATGTGAGAGGAAGCAGAATGG + Intergenic
1201555919 Y:15264601-15264623 AAATACCAGAAGAAGCAAAATGG + Intergenic
1201568424 Y:15389953-15389975 AAATACCTGAGGAAGCATAATGG - Intergenic
1201631426 Y:16075146-16075168 AAATACCAGAGGAAGCAGAATGG + Intergenic
1201640083 Y:16168973-16168995 AGATACCAGAAAAAGCAGAATGG - Intergenic
1201662730 Y:16416352-16416374 AGATACCAGAAAAAGCAGAATGG + Intergenic
1201729421 Y:17188743-17188765 AAATACCAGAGGAATCAGAATGG - Intergenic
1201908058 Y:19105314-19105336 AAATACAAGAGGAAGAAGAATGG - Intergenic
1202243059 Y:22790041-22790063 AAATACCAGAAGAAGCAGAATGG + Intergenic
1202258056 Y:22941197-22941219 AAATACCAGAGGAAGCAGAATGG + Intergenic
1202271862 Y:23081038-23081060 AAATACCAGAGGAAGCAAAATGG - Intergenic
1202294164 Y:23339644-23339666 AAATACCAGAGGAAGCAAAATGG + Intergenic
1202396046 Y:24423791-24423813 AAATACCAGAAGAAGCAGAATGG + Intergenic
1202411046 Y:24574955-24574977 AAATACCAGAGGAAGCAGAATGG + Intergenic
1202424859 Y:24714782-24714804 AAATACCAGAGGAAGCAAAATGG - Intergenic
1202445930 Y:24955303-24955325 AAATACCAGAGGAAGCAAAATGG + Intergenic
1202459735 Y:25095117-25095139 AAATACCAGAGGAAGCAGAATGG - Intergenic
1202474739 Y:25246301-25246323 AAATACCAGAAGAAGCAGAATGG - Intergenic