ID: 1196535638

View in Genome Browser
Species Human (GRCh38)
Location X:116840217-116840239
Sequence GGTTAGGTTTTAAACTTCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196535632_1196535638 24 Left 1196535632 X:116840170-116840192 CCGTAGATATTAAATTTATAGAC No data
Right 1196535638 X:116840217-116840239 GGTTAGGTTTTAAACTTCAGGGG No data
1196535633_1196535638 -2 Left 1196535633 X:116840196-116840218 CCTTAATGCAACTTCAATAAAGG No data
Right 1196535638 X:116840217-116840239 GGTTAGGTTTTAAACTTCAGGGG No data
1196535631_1196535638 27 Left 1196535631 X:116840167-116840189 CCACCGTAGATATTAAATTTATA No data
Right 1196535638 X:116840217-116840239 GGTTAGGTTTTAAACTTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196535638 Original CRISPR GGTTAGGTTTTAAACTTCAG GGG Intergenic
No off target data available for this crispr