ID: 1196538774

View in Genome Browser
Species Human (GRCh38)
Location X:116880947-116880969
Sequence GACGCACTTAATGTGCTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196538774_1196538776 -6 Left 1196538774 X:116880947-116880969 CCCTTCAGCACATTAAGTGCGTC No data
Right 1196538776 X:116880964-116880986 TGCGTCATGCCACTCTCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196538774 Original CRISPR GACGCACTTAATGTGCTGAA GGG (reversed) Intergenic
No off target data available for this crispr