ID: 1196540573

View in Genome Browser
Species Human (GRCh38)
Location X:116902042-116902064
Sequence TGTGTTACAAATTAAAAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196540573_1196540574 -8 Left 1196540573 X:116902042-116902064 CCTGACTTTTAATTTGTAACACA No data
Right 1196540574 X:116902057-116902079 GTAACACAATTTTACAAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196540573 Original CRISPR TGTGTTACAAATTAAAAGTC AGG (reversed) Intergenic
No off target data available for this crispr