ID: 1196545708

View in Genome Browser
Species Human (GRCh38)
Location X:116962340-116962362
Sequence GCAGCCAGGAAGTTCAAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196545708_1196545711 -5 Left 1196545708 X:116962340-116962362 CCCAGTTTGAACTTCCTGGCTGC No data
Right 1196545711 X:116962358-116962380 GCTGCTTTGTTTACACTGTGAGG 0: 10
1: 236
2: 552
3: 440
4: 368
1196545708_1196545713 26 Left 1196545708 X:116962340-116962362 CCCAGTTTGAACTTCCTGGCTGC No data
Right 1196545713 X:116962389-116962411 ACCTACTCAAGCCTCAGCAGTGG 0: 37
1: 1394
2: 1634
3: 1502
4: 1414
1196545708_1196545712 -4 Left 1196545708 X:116962340-116962362 CCCAGTTTGAACTTCCTGGCTGC No data
Right 1196545712 X:116962359-116962381 CTGCTTTGTTTACACTGTGAGGG 0: 15
1: 247
2: 607
3: 415
4: 394
1196545708_1196545715 29 Left 1196545708 X:116962340-116962362 CCCAGTTTGAACTTCCTGGCTGC No data
Right 1196545715 X:116962392-116962414 TACTCAAGCCTCAGCAGTGGCGG 0: 30
1: 1093
2: 1343
3: 936
4: 921

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196545708 Original CRISPR GCAGCCAGGAAGTTCAAACT GGG (reversed) Intergenic
No off target data available for this crispr