ID: 1196545711

View in Genome Browser
Species Human (GRCh38)
Location X:116962358-116962380
Sequence GCTGCTTTGTTTACACTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1606
Summary {0: 10, 1: 236, 2: 552, 3: 440, 4: 368}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196545708_1196545711 -5 Left 1196545708 X:116962340-116962362 CCCAGTTTGAACTTCCTGGCTGC No data
Right 1196545711 X:116962358-116962380 GCTGCTTTGTTTACACTGTGAGG 0: 10
1: 236
2: 552
3: 440
4: 368
1196545709_1196545711 -6 Left 1196545709 X:116962341-116962363 CCAGTTTGAACTTCCTGGCTGCT No data
Right 1196545711 X:116962358-116962380 GCTGCTTTGTTTACACTGTGAGG 0: 10
1: 236
2: 552
3: 440
4: 368
1196545706_1196545711 20 Left 1196545706 X:116962315-116962337 CCTTGCTGAGCTGTGGTGGGGTC 0: 4
1: 189
2: 336
3: 583
4: 4089
Right 1196545711 X:116962358-116962380 GCTGCTTTGTTTACACTGTGAGG 0: 10
1: 236
2: 552
3: 440
4: 368

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196545711 Original CRISPR GCTGCTTTGTTTACACTGTG AGG Intergenic
900039050 1:441591-441613 GTGGCTTTGTTTACACTGTGGGG - Intergenic
900060482 1:676567-676589 GTGGCTTTGTTTACACTGTGGGG - Intergenic
902141569 1:14361215-14361237 GCAGCTTTGTTTACACTGTGAGG + Intergenic
903566899 1:24274532-24274554 GAGGCGTTGTTTACACTGTGAGG + Intergenic
905690812 1:39941299-39941321 GCCCCTTTGTTTGCCCTGTGGGG - Intergenic
906095864 1:43223462-43223484 GATGCTTAGTTTACAAAGTGGGG + Intronic
906249880 1:44302730-44302752 TCTCCTTTGTTTGCACTGAGTGG - Intronic
906294498 1:44641160-44641182 GTTGCTCAGTTTTCACTGTGAGG + Intronic
906557871 1:46728700-46728722 GAGGCTTTGTTTACACTGTGAGG - Intergenic
906586766 1:46985066-46985088 GCTGCTTAGTTTACACTGTGAGG - Intergenic
906739935 1:48173002-48173024 GCCGCTTTCTTTATACTGTGAGG + Intergenic
906753221 1:48285210-48285232 GCAGCTTTGTTTACACTGTGAGG + Intergenic
906890649 1:49709339-49709361 GAGGCTGTGTTTATACTGTGAGG + Intronic
906901113 1:49837338-49837360 GCAGCTTTGTTTATACTGTGAGG + Intronic
907015199 1:51005581-51005603 GTGGCTTTGTTTACACTGTGAGG - Intergenic
907565648 1:55430922-55430944 GTGTCTTTGTTTACACTGTGAGG - Intergenic
907600144 1:55760737-55760759 ACGGCTTTGTTTACACCGTGAGG - Intergenic
907823044 1:57989439-57989461 GCTTCATTCTTTAAACTGTGTGG - Intronic
907953556 1:59206842-59206864 GTGGCTTTGTTTACACTGTGCGG - Intergenic
907984476 1:59517073-59517095 GTAGCTTTGTTTGCACTTTGTGG + Intronic
908168527 1:61482372-61482394 GCTGATTTGGTTCCACCGTGGGG + Intergenic
908584608 1:65554494-65554516 GAGACCTTGTTTACACTGTGAGG + Intronic
909415685 1:75403054-75403076 ACAGCTTTGTTTACACTGTGAGG - Intronic
909536409 1:76741419-76741441 GCAGCTGTGTTTACACTGTGAGG + Intergenic
909672419 1:78203765-78203787 GCTGCTTTGTTTACACTGTGAGG - Intergenic
909690125 1:78398008-78398030 GCAGCTTTGTTCACACTGTGAGG + Intronic
910177216 1:84443428-84443450 GTGGCTTTGTTTACACTGTGAGG - Intergenic
910311668 1:85830983-85831005 GCTTCTTTGTTTGCATTCTGAGG + Intronic
910331016 1:86072368-86072390 GCAGCTTTGTTTACACTGTGAGG - Intronic
910805719 1:91188422-91188444 GCAGCTTTGCTTACACTGTGAGG + Intergenic
910827828 1:91428251-91428273 GCAGCTTCCTTAACACTGTGAGG + Intergenic
911270669 1:95797572-95797594 GTGGCTTTGTTTACACTGTGTGG - Intergenic
911632671 1:100200265-100200287 GTGGCTTTATTTACACTGTGAGG - Intronic
911692030 1:100845423-100845445 GTGGCTTTATTTACACTGCGAGG + Intergenic
911713329 1:101099753-101099775 GCTGCCATGTTGAGACTGTGAGG + Intergenic
912076712 1:105884469-105884491 GCAGCTTTATTTATACTGTGAGG + Intergenic
912126488 1:106545406-106545428 GATGCTTTGTCTACTCTGTGGGG + Intergenic
912150533 1:106853609-106853631 GTGGCTTTGTTTACACTGTGAGG - Intergenic
912222367 1:107692894-107692916 GTTACTTTGTTTAAACTGAGAGG + Intronic
912235351 1:107844662-107844684 GAGGCTTTGTTTATACTGTGAGG - Intronic
912271025 1:108209227-108209249 GGGGCTCTGTTTACACTGTGAGG + Intergenic
912301382 1:108520521-108520543 GCGGCTTTATTTACACTGTGAGG + Intergenic
912675812 1:111679763-111679785 GAGGCTTTGTTTACATTGTGAGG - Intronic
912894857 1:113575972-113575994 GCGGCTTCCTTAACACTGTGAGG + Intronic
912966260 1:114239935-114239957 GTGGCTTTGTTTTCACTGTGAGG - Intergenic
913108644 1:115639254-115639276 GTGGCTTTCTTTACACTGTCAGG + Intergenic
913210492 1:116578321-116578343 ACTGCTTTGTTTTCGCTTTGAGG + Intronic
913430088 1:118781060-118781082 GTGGCTTTGTTTACACTGTGAGG + Intergenic
913720364 1:121586935-121586957 GTGGCTTTGTTTACACTGTGAGG + Intergenic
914253703 1:145943462-145943484 TCCTCTTTGTTTCCACTGTGGGG - Intronic
914458068 1:147855206-147855228 GCGGCTTTGTTTACACTGTGAGG - Intergenic
914967115 1:152269931-152269953 GCAGCTTTGTTTATACTGTGAGG + Intergenic
914969252 1:152292186-152292208 GCAGCTTTGTTTATACTGTGAGG - Intergenic
915771758 1:158432814-158432836 GTGGCTTTGTTTACACTGTGAGG + Intergenic
915992250 1:160529731-160529753 GCAGCTTTGTTTACACTGTGAGG + Intergenic
916359566 1:163952913-163952935 ACAGCTTTGTTTACACTGTAGGG - Intergenic
916362886 1:163990641-163990663 GAGGCTTTGTTTACACTGTGAGG - Intergenic
916379680 1:164195793-164195815 GAGTCTTTGTTTACACTGTGAGG - Intergenic
916406294 1:164500837-164500859 TTGGCTTTGTTTACACTGTGAGG - Intergenic
916612785 1:166409689-166409711 ATGGCTTTGTTTACACTGTGAGG + Intergenic
916625584 1:166552201-166552223 GTGGCTTTGTTTACACTGTGAGG + Intergenic
916754640 1:167757198-167757220 GCTGCCTTGCTGCCACTGTGGGG - Intronic
916855835 1:168748640-168748662 GCTCCTTTGTTTGCACAATGTGG + Intergenic
916878708 1:168998353-168998375 GAGGCGTTGTTTACACTGTGAGG + Intergenic
916938564 1:169656623-169656645 GCAACTTTGTTTACACTGTGAGG - Intergenic
917009754 1:170457843-170457865 GCAGCTTTGTTTACACTGTGAGG + Intergenic
917023357 1:170614311-170614333 GTGGCTTTGTTTACACTATTAGG + Intergenic
917091748 1:171359894-171359916 GTGGCTTTATTTACACTCTGAGG - Intergenic
917157958 1:172025160-172025182 GTGGCTTTGTTTACACTGTGAGG - Intronic
917163130 1:172080406-172080428 GCAGCTTTGCTTACACTGTGAGG + Intronic
917357770 1:174144228-174144250 GCAGTTTTGTTTATACTGTGAGG - Intergenic
917401359 1:174653079-174653101 GAGGCTTTGTTTACACTGTGAGG + Intronic
917405980 1:174709030-174709052 GAGGCTTTGTTTACACTGTGAGG - Intronic
917584965 1:176416951-176416973 GCAGCCTTGTTTACACTTTGAGG + Intergenic
918163375 1:181921093-181921115 GAGGCTTTGTTTATGCTGTGAGG - Intergenic
918167227 1:181961708-181961730 GCGGCTTTGTTTACACTGTGAGG + Intergenic
918195671 1:182219136-182219158 GCATCTTTGTTTAAACCGTGAGG - Intergenic
918360386 1:183751344-183751366 ATGGCTTTGTTTACACTGCGAGG + Intronic
918501485 1:185201032-185201054 GGGGCTTTGTTTACACTGTGAGG + Intronic
918612826 1:186512198-186512220 ATGGGTTTGTTTACACTGTGAGG + Intergenic
918632073 1:186730381-186730403 GCGGCTTTGTTTACGCTGTGGGG + Intergenic
918684415 1:187397173-187397195 GCGGGTTTATTTACACTGTGAGG - Intergenic
918720738 1:187849658-187849680 GCTAGTTTATTTACACTATGTGG + Intergenic
919146763 1:193645177-193645199 GAGGCTTTGTTTACACTGTGAGG + Intergenic
919149793 1:193681267-193681289 GCTGCTGAAGTTACACTGTGAGG + Intergenic
919461650 1:197884300-197884322 GCAGCTTTGTTTACACTGTGAGG + Intergenic
919599009 1:199599826-199599848 GAGGCTTTGTTTTCATTGTGAGG - Intergenic
919601908 1:199633201-199633223 GAGGCTTTGTTTACACTGTGAGG - Intergenic
920306371 1:205020720-205020742 GCTGCTTTGCTAACTCTCTGAGG + Exonic
920985604 1:210885752-210885774 GCAGCTTTTTTTATACTGTGAGG - Intronic
921296837 1:213712296-213712318 GCAGCTTTGTTTACACTGTGAGG + Intergenic
921401369 1:214727431-214727453 GTGGCTTTGTTTACACTGTGAGG + Intergenic
921461538 1:215432914-215432936 GTGGCTTTGTTTACACTGTGAGG + Intergenic
921484842 1:215703594-215703616 GTGGCTTTGTTCACACTGTGAGG + Intronic
921626197 1:217380024-217380046 GCGGCTTTGTTTACACTGTGAGG - Intergenic
921631360 1:217437592-217437614 GCAGCTTTGTTTACACTGTGAGG - Intronic
921943124 1:220863888-220863910 GCGTCTTTGTTTACACTGTGAGG + Intergenic
921962252 1:221047794-221047816 ACAGTTTTGTTTACACTGTGAGG - Intergenic
921976346 1:221207258-221207280 GCGGCTTTGTTTACACTATGAGG - Intergenic
922066223 1:222146132-222146154 ACAGCTTTGTTTACACTGTGAGG - Intergenic
922380015 1:225013736-225013758 GGGGCTTTGTTTACACTGTGAGG + Intronic
922396810 1:225210369-225210391 GTTCCTTTGTTTACACAGTGAGG - Intronic
922406205 1:225316133-225316155 GCAGCTTTGTTTACACTGTGAGG + Intronic
922691927 1:227699987-227700009 GAGGCTTTGTTTACACTGTTAGG - Intergenic
922716024 1:227872546-227872568 GAGGCTTTGTTTACACTGTTAGG - Intergenic
922857868 1:228790507-228790529 GCTGCTGTGGTCACACTTTGGGG + Intergenic
923421744 1:233822646-233822668 GTGGCTTTGTTTACACTGTGAGG - Intergenic
923690895 1:236192103-236192125 GCGGCTTTGTTTACACTGTGAGG + Intronic
923853446 1:237820881-237820903 GTGGCTTTGTTTACATTGTGAGG - Intronic
924179965 1:241430731-241430753 GCAGCTTTGTTTACACTGTGAGG + Intergenic
924254598 1:242169791-242169813 GCTGCTTTGTTTACACCGTGAGG - Intronic
924296034 1:242587308-242587330 GCAGCTTTGTTTACACTGTGAGG - Intergenic
924493987 1:244568624-244568646 GCAGCTTTATTTCCACTGTGAGG + Intronic
924828997 1:247572952-247572974 GCGGCTTTGTTTACACTGTGAGG + Intronic
1064315775 10:14254573-14254595 GCACCTTTCTTTACAATGTGGGG + Intronic
1065075988 10:22080066-22080088 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1065485592 10:26233835-26233857 GCTGCTGTGTTGACTCAGTGAGG + Intronic
1065621621 10:27587678-27587700 GTGCCTTTGTTTATACTGTGAGG - Intergenic
1065651752 10:27899672-27899694 GAGGCTTTGTTTACACTGTGAGG - Intronic
1066140800 10:32502010-32502032 GCGGCTTTGTTTACACTGTAAGG + Intronic
1066159675 10:32714754-32714776 GCAGCTTTGTTTACACTGTGAGG - Intronic
1066257626 10:33696066-33696088 GTGGTTTTGGTTACACTGTGAGG + Intergenic
1066462016 10:35620466-35620488 CCTGATTTATTTACCCTGTGTGG + Intergenic
1066993476 10:42539488-42539510 GCAGCTTTGTTTACACTGTGAGG + Intergenic
1067209677 10:44249696-44249718 GAAGCTCTGTTTACACTGTGAGG + Intergenic
1067236363 10:44453978-44454000 GCAGTGTTGTTTACACTGTGAGG + Intergenic
1067325915 10:45266249-45266271 GCCCCTTTGTTTACACTGTGAGG - Intergenic
1068086082 10:52375009-52375031 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1068357093 10:55923292-55923314 GGGGCTTTGTTTACACTGTGAGG + Intergenic
1068469945 10:57448260-57448282 GTGGTTTTGTTTATACTGTGAGG + Intergenic
1068622972 10:59207473-59207495 GTGGCTTTGTTTACACTGTGAGG - Intronic
1069093461 10:64229730-64229752 GCAGCTTTGTTTACACTGTGAGG + Intergenic
1069139914 10:64810216-64810238 GCGGCTTTGTTTACACTGTGAGG + Intergenic
1069264279 10:66438480-66438502 GTGGCTTTGTTTACACTGTGAGG + Intronic
1069348968 10:67502749-67502771 ACAGCTTTGTTTACATTGTGAGG + Intronic
1070234448 10:74609019-74609041 GCATCTTTGTTTACACTGTTAGG + Intronic
1070349272 10:75576227-75576249 GTGGCTTTGTTTACACTGTGAGG - Intronic
1071190067 10:83089551-83089573 GTGGCTTTGTTTACATTGTGAGG - Intergenic
1071975842 10:90955083-90955105 ACAGCTTTGTTTACACTGTGAGG + Intergenic
1072044904 10:91644521-91644543 GTAGCTTTGTTTACACTGTGAGG - Intergenic
1072358950 10:94640128-94640150 GGAGCTTTGTTTGCACTATGAGG + Intergenic
1072365344 10:94703515-94703537 GAGGTTTTGTTTACACTGTGAGG + Intronic
1072375673 10:94813563-94813585 GAGGCTTTGTTTACACTGTGAGG + Intronic
1072389543 10:94969210-94969232 GAGGCTTTGTTTACACTGTGAGG + Intronic
1072394681 10:95026562-95026584 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1072404418 10:95136541-95136563 GTGGCTTTCTTTACACTGTGAGG - Intergenic
1072493683 10:95934161-95934183 GTGGCTTTGTTTACACTGTAAGG + Intronic
1072876195 10:99175479-99175501 GCTGCTTTGTTTACACTGTGAGG - Intronic
1073182858 10:101596006-101596028 GCTGTTTTATTTGCTCTGTGTGG - Intronic
1073884201 10:108019554-108019576 GCAGCTTTGTTTACACTGTGAGG - Intergenic
1074396235 10:113100185-113100207 GATGCTTTGTTTATAGTGTGTGG - Intronic
1074648501 10:115491528-115491550 GTGGCTTTGTTTACACTGTGAGG + Intronic
1074795493 10:116938947-116938969 GTGGCTTTGTTTACACTGTGAGG + Intronic
1074985157 10:118652056-118652078 GCAGCTCTGTTCACACTGTGAGG + Intergenic
1075983903 10:126766827-126766849 GCAGCTTTGTTTACACTGTGAGG + Intergenic
1076297626 10:129399098-129399120 GTTGTTTAGATTACACTGTGGGG - Intergenic
1076388113 10:130073970-130073992 GCTGATTTACTCACACTGTGAGG - Intergenic
1076389818 10:130090776-130090798 GAGGCTTTGTTTACACTGTGAGG - Intergenic
1076517180 10:131052853-131052875 GCTGATTTGGTTTCTCTGTGGGG + Intergenic
1076965262 11:77500-77522 GTGGCTTTGTTTACACAGTGGGG - Intergenic
1077562034 11:3270195-3270217 TGGGCTTTGTTTACACTGTGAGG + Intergenic
1077567928 11:3316015-3316037 TGGGCTTTGTTTACACTGTGAGG + Intergenic
1077696450 11:4397229-4397251 GCAGTTTTGTTTACACTGTGAGG - Intergenic
1078331471 11:10425870-10425892 GTGGCTTTGTTTACACTATGAGG + Intronic
1078336368 11:10466399-10466421 GTGGCTTTGTTTACACTGTGAGG - Intronic
1078392889 11:10952045-10952067 GGGGCTTTGTTTACACTGTGAGG + Intergenic
1078602900 11:12749140-12749162 GCTGGTTTGTTTTGCCTGTGGGG + Intronic
1078686178 11:13534450-13534472 GCAGCTTTGTTTACACTGTGAGG + Intergenic
1078809413 11:14743342-14743364 GCAGCTTTATTTATGCTGTGAGG + Intronic
1078814110 11:14801911-14801933 GCTGCTTTGTTTACACTGTGAGG + Intronic
1079316540 11:19412282-19412304 GGGGCTTTATTTACACTGTGAGG - Intronic
1079436892 11:20463915-20463937 GCTGTTTTGTTTGAATTGTGTGG + Intronic
1079510561 11:21205394-21205416 GCGGCTTTGTTTACACCGTGAGG + Intronic
1079517882 11:21289851-21289873 GCAGCTTTGTTTACACTGTGAGG - Intronic
1079696136 11:23484379-23484401 GCAGCTTTGTTTACACTGTGAGG - Intergenic
1080334551 11:31181073-31181095 GCGGCTTTGTTTACAATGTGAGG - Intronic
1080881670 11:36327097-36327119 TCTGTTTCATTTACACTGTGAGG + Intronic
1080965607 11:37210894-37210916 GCTGCTTTTTACACACTGTGAGG + Intergenic
1080977167 11:37356930-37356952 ACTGCTTTGTTTACACTGTGAGG - Intergenic
1081080194 11:38731874-38731896 GCTGCTTTGTTTACACTGTGAGG + Intergenic
1081094943 11:38921098-38921120 GTAGCTTTGTTTACACTGTGAGG + Intergenic
1081198809 11:40192811-40192833 GTGGCTTTGTTTACACTGTGAGG - Intronic
1081221601 11:40469740-40469762 GAGGCTTTGTTTACCTTGTGAGG - Intronic
1081317719 11:41650871-41650893 GTAGCCTTGTTTACACTGTGAGG + Intergenic
1081546108 11:44072985-44073007 GCTACTTTTTTTAAAGTGTGAGG + Intronic
1082670716 11:56033484-56033506 GCAGCTTTGTTTACACTATGAGG - Intergenic
1082754740 11:57063214-57063236 GCTGCTTTGTTTACCTAGTCAGG - Intergenic
1082872127 11:57953320-57953342 GGGGCTCTGTTTACACTGTGAGG + Intergenic
1083510233 11:63202511-63202533 GTGTCTTTGTTTACACTGTGAGG - Intronic
1085683783 11:78603216-78603238 GCGGCTTTGTTTACACTGTGAGG + Intergenic
1085884462 11:80505934-80505956 GCGGCTTTGTTTACACTGTGAGG - Intergenic
1086067905 11:82765700-82765722 GTAGCTTCGTTTACACTGTGAGG + Intergenic
1086086023 11:82956164-82956186 GAGGCTTTGTTTACACTGTGAGG + Intronic
1086129214 11:83383327-83383349 GTGGCTTTGTTTACACTGTGAGG - Intergenic
1086300323 11:85420713-85420735 ACAGCTTTGTTTACACTGTGAGG + Intronic
1086312292 11:85548771-85548793 GTGTCTTTGTTTATACTGTGAGG + Intronic
1086348885 11:85924969-85924991 GTGGCTTTGTTTACACTGTGAGG - Intergenic
1086410725 11:86541505-86541527 GCAGCTTTGTTTACACTGTGAGG - Intronic
1086421928 11:86645421-86645443 GTGGCTTTGTTTACACTGTGAGG - Intronic
1086505311 11:87498053-87498075 GTGACTTTGTTTACACTGTGAGG - Intergenic
1086532352 11:87800966-87800988 GTGGCTTTGTTTATACTGTGAGG + Intergenic
1086582910 11:88420163-88420185 GCTGCTTAGGTCATACTGTGTGG + Intergenic
1086608461 11:88725243-88725265 GTGGCTTTGTTTACACTGTGAGG - Intronic
1087427787 11:98012745-98012767 GTGGCTTTCTTTACACTGTGAGG - Intergenic
1087445520 11:98246698-98246720 GCTGTTTTGTTTACAATGTTTGG + Intergenic
1087484879 11:98748373-98748395 GCAGCTTTGTTTACACTGTGAGG - Intergenic
1087596134 11:100257144-100257166 GTGGCTTTGTTTACACTATAAGG - Intronic
1087667801 11:101070683-101070705 GTGGTTTTGCTTACACTGTGAGG - Intronic
1087695283 11:101369588-101369610 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1087703772 11:101466484-101466506 GCCGTTTTGTTTACACTGTGTGG + Intronic
1087712221 11:101567226-101567248 AGGGCTTTGTTTATACTGTGAGG - Intronic
1087830961 11:102819671-102819693 GTGGCTTTGTTTACACTATGAGG + Intergenic
1087925157 11:103910942-103910964 GTAGCTTTGTTTACACTTTGAGG - Intronic
1088078296 11:105878697-105878719 GAGACTTTGTTTACAATGTGGGG + Intronic
1088096592 11:106107810-106107832 TCTGCTTTATTTTCCCTGTGGGG + Intergenic
1088211920 11:107466236-107466258 TGTGCTTTGTTTAAACTGCGAGG + Intergenic
1088272436 11:108048458-108048480 GTGGCTTTCTTTTCACTGTGTGG + Intronic
1088330356 11:108644607-108644629 GCTGATTTGGTTCCTCTGTGGGG + Intergenic
1088702558 11:112426416-112426438 GTAACTTTGTTTACACTGTGAGG - Intergenic
1089168725 11:116498104-116498126 GCTGTTTTGTTTGCTCTGAGGGG - Intergenic
1089285459 11:117404935-117404957 GTGACTTTGTTTACACTGTGAGG + Intronic
1089766012 11:120766234-120766256 GCGGCTTTGTTTACACTGTAAGG + Intronic
1089931212 11:122314357-122314379 GATGCTTTTTTGGCACTGTGTGG + Intergenic
1090312708 11:125756272-125756294 GAGACTTTGTTTACACTCTGTGG - Intergenic
1090688882 11:129156450-129156472 GGGGCTTTGTTTACATTGTGAGG - Intronic
1090720423 11:129467407-129467429 GGGGCTTTGTTTACACTGTGAGG - Intergenic
1090945016 11:131421698-131421720 GTTGCTTTGTTTAAAATTTGAGG - Intronic
1091090015 11:132762595-132762617 GTGGCTTTGTTTACACTGTGAGG + Intronic
1091127468 11:133113778-133113800 GCAGCCTTATTCACACTGTGGGG - Intronic
1091172895 11:133533842-133533864 GCTGCTTTATAAAAACTGTGTGG - Intergenic
1091213506 11:133885022-133885044 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1092304379 12:7283912-7283934 GTGGCTTTGTTTATGCTGTGAGG - Intergenic
1092398779 12:8153663-8153685 GTGGCTTTGTTTACATTGTGAGG + Intronic
1092567685 12:9685636-9685658 AGGGCTTTGTTTACACTGTGAGG + Intronic
1092638900 12:10482024-10482046 GTGGCTTTGTTTACACTGTAAGG - Intergenic
1092690915 12:11109027-11109049 GTGGCTTTGTTTACACCGTAAGG - Intronic
1093004432 12:14036135-14036157 GTGGCTTTGTTTACACTGTGAGG - Intergenic
1093331019 12:17839368-17839390 TCTTTTTTGTTTACATTGTGTGG + Intergenic
1093336036 12:17905836-17905858 GTGGCTTTGTTTACACTGAGGGG + Intergenic
1093545033 12:20336392-20336414 GCGGCTTTGTTTACAATGTAGGG + Intergenic
1093610542 12:21150059-21150081 GTGGCTTTGTTTGCATTGTGAGG - Intronic
1093664453 12:21795331-21795353 GCAGCTTTGTTTACACTGTGAGG + Intergenic
1093694769 12:22146841-22146863 ACAGCTTTGTTTACACTGTGAGG - Intronic
1093714509 12:22366296-22366318 GTGGCTTTGTTTACGCTGTGAGG - Intronic
1093835587 12:23824869-23824891 GCAGCTTTGTTTAAACTGTGAGG + Intronic
1094140018 12:27171656-27171678 GTGGCTTTATTTACACTGTGAGG + Intergenic
1094357156 12:29590090-29590112 GCTCATTTGTTTACATGGTGTGG - Intronic
1094733104 12:33200647-33200669 GCTGCTTTGTTTACACTGTGAGG + Intergenic
1094755418 12:33463075-33463097 GTGGTTTTATTTACACTGTGAGG - Intergenic
1094757870 12:33492928-33492950 ACAATTTTGTTTACACTGTGAGG - Intergenic
1094782050 12:33802614-33802636 GAGGCTTTGTTTACACTGTAAGG + Intergenic
1095119924 12:38405143-38405165 CCAGCTTTGTTTACACTGTGAGG + Intergenic
1095230486 12:39733685-39733707 GTGGCTTTGTTTACACTGTGAGG + Intronic
1095247856 12:39943536-39943558 GCAGCTTTGTTTACACTGTGAGG + Intronic
1095356437 12:41280571-41280593 GTAGCTTTGTTTACACTGTGAGG - Intronic
1095488501 12:42708551-42708573 GCAGCTTTGTTTACACTGTGAGG - Intergenic
1095651201 12:44611508-44611530 GCTGCTTTCTTTGCAGAGTGAGG - Intronic
1095694879 12:45132907-45132929 GTGGCTTTCTTTACACTGTGAGG - Intergenic
1095778885 12:46037239-46037261 GTGGCTTTGTTTACAGTGTGAGG - Intergenic
1095917837 12:47497925-47497947 CCGGCTTTGTTTACACTGTGAGG - Intergenic
1096941858 12:55355586-55355608 GTGGCTTTGTTTACACTGTGAGG - Intergenic
1097375803 12:58841157-58841179 GCAGCTTTGTTTACACTGTGAGG + Intergenic
1097435548 12:59549123-59549145 GCGGCTTTGTTTACACTGTGAGG + Intergenic
1097488452 12:60235032-60235054 GTGCCTTTGTTTACACTGTGAGG - Intergenic
1097526635 12:60745795-60745817 GTGGCTTTGTTTACACTGTGAGG - Intergenic
1097619525 12:61922954-61922976 GTGGCTTTGTTTACGCTGTCGGG - Intronic
1097635181 12:62113774-62113796 GCGGCTTTGTTTACAATGTGAGG + Intronic
1097737397 12:63196880-63196902 GCAGCTTTGTTTACACTGTGAGG - Intergenic
1097948792 12:65403387-65403409 GCGGCTTTGTTTACACTGTGAGG + Intronic
1098052946 12:66473185-66473207 GTGGCTTTGTTTACACTGTGAGG - Intronic
1098151857 12:67555491-67555513 GAGGCTTTGTTTACACTGTGAGG + Intergenic
1098183172 12:67869655-67869677 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1098438773 12:70496987-70497009 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1098635637 12:72780559-72780581 ATGGCTTTGTTTACACTGTGAGG - Intergenic
1098780176 12:74676742-74676764 GTGGCTTTGCTTACACTGTGAGG - Intergenic
1098906636 12:76169628-76169650 CGAACTTTGTTTACACTGTGAGG + Intergenic
1099053453 12:77808956-77808978 GTGGCTTTTTTTACACTGTGAGG + Intergenic
1099071353 12:78049000-78049022 GCGGGTTTGTTTACATTGTGAGG + Intronic
1099236090 12:80084055-80084077 GTGGCTTTGTTTACATCGTGAGG + Intergenic
1099238915 12:80115832-80115854 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1099435253 12:82634937-82634959 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1099492051 12:83300106-83300128 AAAGCTTTTTTTACACTGTGAGG - Intergenic
1099554788 12:84097783-84097805 GTGGCTTTGTTTACACTGTGAGG - Intergenic
1099699132 12:86061732-86061754 ATGACTTTGTTTACACTGTGAGG - Intronic
1099744964 12:86690096-86690118 GTGGCTTTGTTTACACTATTAGG + Intronic
1099797995 12:87422439-87422461 GAGGCTTTGTTTAAACTGTGAGG + Intergenic
1099878447 12:88437331-88437353 GTGGCTTTGTCTACACTTTGAGG - Intergenic
1099897560 12:88667814-88667836 ACGGCTTTGTTTACACTGTGAGG - Intergenic
1100111065 12:91242915-91242937 GCCGGTTTGTTTACATTGTGAGG - Intergenic
1100136287 12:91557140-91557162 GGAGCTTTGTTTACACTGTGAGG - Intergenic
1100740059 12:97581747-97581769 GTGGCTTTGTTTACACTGTGAGG - Intergenic
1100768721 12:97898088-97898110 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1100798010 12:98202344-98202366 GTGGCTTTGTTTATACTGTGAGG - Intergenic
1100799692 12:98218162-98218184 GTTTGTTTGTTTATACTGTGAGG + Intergenic
1100996250 12:100304038-100304060 GCGGCTTTGTTTACACTGTGAGG + Intronic
1101069849 12:101062666-101062688 GCGGCTTTGTTTACACTGTGAGG + Intronic
1101092676 12:101303770-101303792 GCTGCTGTGTTGAGACTGTAGGG + Intronic
1101296097 12:103425044-103425066 GTGGCTTTGTTTACACTGTGAGG - Intronic
1101296240 12:103425884-103425906 GTGGCTTTGTTTACACTGTGAGG + Intronic
1101472656 12:105013261-105013283 GTGGCTTTATTTACACTGTGAGG + Intronic
1102345562 12:112158971-112158993 GCAGCTTTGTTTACACTGTGAGG + Intergenic
1103255634 12:119539464-119539486 GTGGCTTTGTTTACACTGTGAGG + Intronic
1104115588 12:125746326-125746348 GTGGCTTTGTTTCCACTGTGTGG + Intergenic
1105355120 13:19652790-19652812 GAGGCTTTGCTTACACTATGAGG - Intronic
1105552463 13:21410641-21410663 GCGGCTTTGTTTACACTGTGAGG + Intronic
1105645777 13:22316229-22316251 GCGGCTTTGTTTACACTGTGAGG + Intergenic
1105737372 13:23285390-23285412 GCGGCTTTGTTTGCACTGTGAGG + Intronic
1105769419 13:23594462-23594484 GTGGCTTTGTTTACACTGTGAGG - Intronic
1106025819 13:25954215-25954237 GTGGCTTTGTTTACACTGTGAGG - Intronic
1106086284 13:26544922-26544944 GCTGCTTAGCATACACTGGGTGG - Intergenic
1106335066 13:28776665-28776687 GCAGCTTTGTTTACATTGTGAGG + Intergenic
1106336007 13:28783957-28783979 ATGGCTTTGTTTACACTGTGAGG + Intergenic
1106361885 13:29038824-29038846 GTGGCTTTGTTTACACTGTAAGG + Intronic
1106377426 13:29203293-29203315 GCAGCTTTGTTTACACTGTGAGG + Intronic
1106378797 13:29216160-29216182 GCAGCTTCGTTTACACTGTGAGG + Intronic
1106391146 13:29336924-29336946 GCAGCTTTGTTTACACTGTGAGG + Intronic
1106426575 13:29636440-29636462 GTGGCTTTCTTTACACTGTGAGG + Intergenic
1106429436 13:29665931-29665953 GCAGCTTTGCTTACACTGTAAGG - Intergenic
1106608072 13:31250570-31250592 GTGGCTTTGTTTACACTGTGAGG - Intronic
1106612290 13:31295596-31295618 ACAGCTTTGTTTATACTCTGAGG + Intronic
1106874221 13:34054551-34054573 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1107289812 13:38839737-38839759 GAGGCTTTTTTTACTCTGTGAGG + Intronic
1107473451 13:40712649-40712671 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1107641948 13:42452951-42452973 GTGGTTTTATTTACACTGTGAGG + Intergenic
1107648180 13:42516645-42516667 GTGGCTTTGTTTACACTATGAGG - Intergenic
1107968830 13:45622162-45622184 GTGGCTTTGTTTACATTCTGAGG + Intergenic
1107970841 13:45640961-45640983 GTGGCTTTGTGTACACTATGAGG + Intergenic
1108048799 13:46408874-46408896 GTGGCTTTGTTTATACTGTGAGG + Intronic
1108079257 13:46717154-46717176 GCTGCCTGGGTCACACTGTGGGG + Intronic
1108153796 13:47564291-47564313 GCAGCTTTGTTTACACTGCGAGG - Intergenic
1108188098 13:47908426-47908448 GCCTCTTTGTTTACAGTGTGAGG - Intergenic
1108217711 13:48201246-48201268 GCAGCTTTGTTTACACTGTGAGG - Intergenic
1108235063 13:48394604-48394626 GTGGCTTTGTTTACACTGTGAGG - Intronic
1108236847 13:48416794-48416816 GTGGCTTTGCTTACACTGTGAGG - Intronic
1108262784 13:48675422-48675444 TCAGCTTTGTTTACACTGTGAGG + Intronic
1108383816 13:49879734-49879756 GAGGCTTTGTTTACACTGTGAGG - Intergenic
1108599878 13:51983273-51983295 GTGGCTTTGTTTACACTATGAGG - Intronic
1108858248 13:54822163-54822185 GCAGCTTTGTTTACACTGTGAGG - Intergenic
1108998322 13:56763502-56763524 GTGGCTTTGTTTACACTGTGAGG - Intergenic
1109033864 13:57230303-57230325 TCTGCTTTGTTTACACTGTGAGG - Intergenic
1109187910 13:59292057-59292079 GCAGCTTTGTTTACACTGTGAGG - Intergenic
1109195941 13:59377485-59377507 GTGACTTTGTTTACACTGTGAGG - Intergenic
1109293749 13:60505298-60505320 GTGGCTTTGTTTACACTGTGAGG - Intronic
1109328665 13:60900695-60900717 GCAGCTTTGTTTACACTGTGAGG - Intergenic
1109366610 13:61364572-61364594 GCGGCTTTGTTTACACTGTGAGG - Intergenic
1109457489 13:62611529-62611551 GTGGCTTTGTTTATACTGTGAGG + Intergenic
1109541329 13:63782219-63782241 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1109615431 13:64828374-64828396 GCAGCTTTGTTTACACCGTGAGG - Intergenic
1109626622 13:64982801-64982823 GAGGCTTTGTTTACAATGTGAGG + Intergenic
1109731568 13:66420031-66420053 GTGGCTTTGTTTCCACTTTGAGG - Intronic
1109891180 13:68616983-68617005 GCAGCTTTGTTTACACTGTAAGG - Intergenic
1109902786 13:68795658-68795680 GAGGCTTTGTTTACACTGTGAGG + Intergenic
1110135534 13:72062779-72062801 CCAGCTTTGTTTACATTGTGAGG - Intergenic
1110389722 13:74959816-74959838 GTGACTTTGTTTACACTGTAAGG - Intergenic
1110409385 13:75187149-75187171 GCTGATTTGGTTCCTCTGTGGGG - Intergenic
1110824700 13:79958480-79958502 GTGGCTTTGTTTACACTGTGAGG - Intergenic
1111114220 13:83754787-83754809 GTGGCTTTGTTAACACTGTGAGG - Intergenic
1111627961 13:90813552-90813574 GCTGCTTTGTTTATACTGTGAGG - Intergenic
1111635088 13:90893031-90893053 GAGGCTTTGTTTACACCGTGAGG - Intergenic
1112151935 13:96773535-96773557 GTGGCCTTGTTTACACTGTGAGG - Intronic
1112165859 13:96919075-96919097 TTGGCTTTGTTTACACTGTGAGG - Intergenic
1112708291 13:102097794-102097816 TCTGCTCTGTTTACACAGAGTGG - Intronic
1113131504 13:107042399-107042421 GCACCTTTGTTTACTCTGTCAGG + Intergenic
1113949322 13:114062759-114062781 CCTGCCTTGTTTCCACTGTCTGG - Intronic
1114341953 14:21754435-21754457 GTGGCTTTCTTTACACTGTAAGG - Intergenic
1114585037 14:23803589-23803611 GCAGGTTTGGTTTCACTGTGAGG - Intergenic
1114710082 14:24768812-24768834 GTGTCTTTGTTTACACCGTGAGG - Intergenic
1114744996 14:25137080-25137102 GCGGCTTTGTTTAAACTGTGAGG - Intergenic
1114817682 14:25979519-25979541 GTGGCTTTGTTCACACTGTGAGG - Intergenic
1114844902 14:26309272-26309294 GGGGATTTGCTTACACTGTGTGG - Intergenic
1114870104 14:26645578-26645600 GCGGCTTTGTTTACAGTATGAGG + Intergenic
1114880986 14:26785667-26785689 TCTACTTTTTGTACACTGTGTGG + Intergenic
1115008169 14:28511551-28511573 GTGGCTTTGTTTATGCTGTGAGG + Intergenic
1115043117 14:28955639-28955661 GCAGCTTTGTTTACACTGTAAGG - Intergenic
1115048688 14:29029158-29029180 GAGGCTTTGTTTACATTGTGAGG + Intergenic
1115277054 14:31621064-31621086 GCGGCTTTGTTTACACTGTGAGG + Intronic
1115359800 14:32488310-32488332 GTGGCTTTGTTTACACTGTGAGG + Intronic
1115511289 14:34139998-34140020 GAGGCTTTGTTTACACTGTGAGG - Intronic
1115538063 14:34391877-34391899 GAGGCTTTGTTTCTACTGTGAGG - Intronic
1115691016 14:35843968-35843990 GTGGCTTTGTTTACACTGTGAGG + Intronic
1115721080 14:36161990-36162012 GCAGCTTTGTTTACACCGTGAGG + Intergenic
1115789742 14:36865518-36865540 GCTGCTTTGTTCACCGTGAGTGG - Intronic
1115912144 14:38268737-38268759 GTGGCTTTGATTACACTGTAAGG + Intergenic
1115974391 14:38980973-38980995 GTGACTTTGTTTACACTGTGAGG + Intergenic
1116259847 14:42611346-42611368 GCTACTTTGTTTCCTCTCTGTGG - Intergenic
1116572431 14:46534889-46534911 GCAGCTTTATTTACAATGTGAGG + Intergenic
1116743874 14:48792824-48792846 GTAGCTTTGTTTACACTGTGAGG - Intergenic
1116771453 14:49131554-49131576 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1116775737 14:49178835-49178857 GTGGCTTTGTTTACACTTTGAGG - Intergenic
1117051917 14:51869075-51869097 AGTGCTTTCTTTACTCTGTGTGG - Intronic
1117121079 14:52568652-52568674 GTGGCTTTGTTTACACCCTGAGG - Intronic
1117237984 14:53798572-53798594 GTGGCTTTGTTTACACTGTGAGG - Intergenic
1117299240 14:54407628-54407650 CTGGCTTTGTTTACACTGTGAGG + Intronic
1117655483 14:57951643-57951665 GAGGCTTTGTTTACACTGTGAGG - Intronic
1117710709 14:58525918-58525940 GCGGCTTTGTTTACACTGAGGGG - Intronic
1117821872 14:59658103-59658125 TCGGCTTTGTTTACACTGTGAGG - Intronic
1117859380 14:60073842-60073864 ACAGTTTTGTTTACACCGTGAGG - Intergenic
1117930527 14:60837003-60837025 GATGCTTTGTTTACACTGTGAGG + Intronic
1118516078 14:66530228-66530250 TGGGCTTTGTTTACACCGTGAGG + Intronic
1118544730 14:66873622-66873644 GCTGCTTTGTTTATGCTGTGAGG - Intronic
1119018468 14:71084628-71084650 GCAGCTTTGCTTACACTGTGAGG + Intronic
1120201346 14:81541036-81541058 GTGGCTTTGTTTACACTGTGAGG - Intergenic
1120271767 14:82321871-82321893 GCAGCTTTGTTTACACTGTGAGG + Intergenic
1120450027 14:84655351-84655373 GCGACTTTGTTTACACTGTGAGG + Intergenic
1120554101 14:85907702-85907724 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1120565312 14:86048118-86048140 GTGGCTTTGTTTATACTGTGAGG + Intergenic
1120770130 14:88370228-88370250 GCAGCTTTGTTTACACTGTGAGG - Intergenic
1120773832 14:88411153-88411175 GCGGCTTTGTTTACACTGTGAGG + Intronic
1120843146 14:89104605-89104627 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1121899007 14:97674988-97675010 GTGGCTTTTTTTACACTGTGAGG - Intergenic
1123480840 15:20629448-20629470 GTGACTCTGTTTACACTGTGAGG - Intergenic
1123552813 15:21398935-21398957 GCTGCTCTGTTTTCTCTGTGTGG + Intergenic
1123553031 15:21400215-21400237 GCTGCTCTGTTTTCTCTGTGTGG + Intergenic
1123589059 15:21836323-21836345 GCTGCTCTGTTTTCTCTGTGTGG + Intergenic
1123589276 15:21837603-21837625 GCTGCTCTGTTTTCTCTGTGTGG + Intergenic
1123637172 15:22370917-22370939 GTGACTCTGTTTACACTGTGAGG + Intergenic
1123864197 15:24500794-24500816 TCTGCTTTTTTTAAACTGTAGGG + Intergenic
1124084217 15:26531716-26531738 GCGGCTTTGTTTACACTGTAAGG - Intergenic
1124322447 15:28725358-28725380 GCTCCTGGGATTACACTGTGAGG - Intronic
1124345260 15:28917999-28918021 GCTGCTTAGATGCCACTGTGGGG + Intronic
1124666719 15:31598865-31598887 GCGGCTTTGTTTACACTGTGAGG - Intronic
1124893962 15:33758501-33758523 GCAGCTTTGTTTATACTGTGAGG - Intronic
1125182614 15:36895006-36895028 CCTGCTTTCTTTACATTGGGTGG - Intronic
1125227185 15:37408514-37408536 GCAGCTATGTTTACATTCTGAGG - Intergenic
1125288528 15:38120081-38120103 GTGGCTTTGTTTACACTGTGAGG - Intergenic
1125329992 15:38573349-38573371 GCGGCTTCATTTACACTGTGAGG + Intergenic
1125354533 15:38803253-38803275 GCAGCTTTCTTTACACTGTGAGG + Intergenic
1125984743 15:44039045-44039067 GAGGCTTTGTTTACACTGTGAGG - Intronic
1126050842 15:44683448-44683470 GTGGCTTTGTTTACACTGTGAGG - Intronic
1126167871 15:45668837-45668859 GCCACTTTGTTTACACTTTTTGG + Intronic
1126389441 15:48130820-48130842 TCTTTTTTGTTTACACTTTGTGG - Intronic
1126500531 15:49339899-49339921 GAGGCTTTGTTTACACTGTGCGG + Intronic
1126554098 15:49966479-49966501 CTGGCTTTGTTTACACCGTGAGG - Intronic
1126720100 15:51569298-51569320 GCAGCTTTGTTTACACTGTGAGG - Intronic
1126952185 15:53893631-53893653 GCAGCTTTGTTTACACTCTGAGG + Intergenic
1127030034 15:54851395-54851417 ATGGCTTTGTTTACACTGTGAGG - Intergenic
1127373744 15:58363259-58363281 GCGGCTTTTTTTACACTGTGAGG - Intronic
1127452575 15:59131320-59131342 GCAGCTTTGTTTACACTGTGAGG + Intergenic
1128883687 15:71265816-71265838 GCGGCTTTGTTTACATTGTGAGG - Intronic
1129126784 15:73448357-73448379 GTGGCTTTGTTTACACTGTAAGG - Intronic
1129495574 15:75977111-75977133 GCAGTTTTGTTTACACTATGAGG + Intronic
1129499140 15:76019113-76019135 GCGGCTTTGTTTACACTGTGAGG + Intronic
1129562435 15:76585867-76585889 GCTCCTGTTTTTGCACTGTGAGG - Intronic
1129563219 15:76593180-76593202 GTGGCTTTGTTTACCCTGTGAGG - Intronic
1129895842 15:79105275-79105297 GCTGCTTTGTGTTCACTCTGTGG + Intergenic
1130441935 15:83963366-83963388 GAGGCTTTGTTTACACTGTGAGG - Intronic
1130724039 15:86419822-86419844 GCGGCTTTGTTTACACTGTGAGG - Intronic
1130728662 15:86467254-86467276 ATGGCTTTGTTTACACTGTGAGG + Intronic
1132067104 15:98740771-98740793 GCCACCTTGTTTAAACTGTGTGG - Intronic
1132096430 15:98988349-98988371 GTGGCTTTGTTTACACTGTGAGG - Intronic
1132442865 15:101886020-101886042 GTGGCTTTGTTTACACTGTGGGG + Intergenic
1202961163 15_KI270727v1_random:126155-126177 GCTGCTCTGTTTTCTCTGTGTGG + Intergenic
1202961379 15_KI270727v1_random:127435-127457 GCTGCTCTGTTTTCTCTGTGTGG + Intergenic
1133956974 16:10452865-10452887 GTGGCTTTGTTTGCACTGTGAGG + Intronic
1134767607 16:16774523-16774545 GCAGCTTTGTTTACACTGTGAGG + Intergenic
1135807568 16:25556499-25556521 GCGGCTTTGTTTACACTGTGAGG - Intergenic
1135953096 16:26933572-26933594 GCTGCTAGGCTTAAACTGTGAGG - Intergenic
1137296333 16:47097381-47097403 GTGGCTTTGTTTACACTGTGAGG - Intronic
1137336465 16:47554298-47554320 ATGACTTTGTTTACACTGTGAGG + Intronic
1137828110 16:51517133-51517155 GAGGCTTCGTTTACACTGTGAGG - Intergenic
1137969976 16:52975349-52975371 GGGGCTTTGTTTACACTGTGAGG + Intergenic
1138151559 16:54662021-54662043 GAGGCTTTGTTTATACTGTGAGG - Intergenic
1138886925 16:61091128-61091150 GTGGCTTTGTTTGCACCGTGAGG - Intergenic
1140173685 16:72633610-72633632 GCTGTTTTGTTTAAACTTTGTGG - Intergenic
1140351742 16:74268695-74268717 GCTGCTTTTTCTACACCTTGAGG - Intergenic
1140865699 16:79059929-79059951 GCTGCTTTTGGTACACTGAGAGG + Intronic
1141136328 16:81468055-81468077 GCTCCTTTGTTTCTAATGTGGGG + Intronic
1141246101 16:82309194-82309216 GCGGCTTTGTTTACATTGTGAGG + Intergenic
1143108780 17:4542258-4542280 GCTCCTGTGTGTTCACTGTGTGG + Intronic
1143427130 17:6848974-6848996 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1146623744 17:34420279-34420301 GCGTCTTTTTTTACACTATGTGG + Intergenic
1146742852 17:35301508-35301530 GAGGCTTTGTTTACACTGTGAGG - Intergenic
1146746315 17:35333709-35333731 GCAGCTTTGTTTACGCTGTGAGG + Intergenic
1146825923 17:36023320-36023342 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1146835103 17:36104552-36104574 GCTGCTTTTCTTACACCGCGAGG + Exonic
1146849718 17:36211800-36211822 GCTGCTTTTCTTACACCGCGAGG + Exonic
1147525275 17:41216525-41216547 GCAACTTTGTTTACACTGTGAGG - Intronic
1148967397 17:51447331-51447353 GCGGCTTTGTTTACACTGTGAGG - Intergenic
1149222898 17:54436207-54436229 GCAGCATTGTTTACACTGTGAGG - Intergenic
1149281260 17:55108190-55108212 GCAGCTTTGTTTACACTCTGAGG + Intronic
1153055214 18:939020-939042 CCTGCTTTGTTTTTACTTTGTGG + Intergenic
1153059366 18:979876-979898 ATGGCTTTGTTTACACTATGAGG + Intergenic
1153562229 18:6383092-6383114 GCAGCTTTGTTTACACTGTGAGG + Intronic
1153743263 18:8151407-8151429 GTGGCTTTGTTTATACTATGAGG + Intronic
1154453724 18:14502332-14502354 GCTGCTCTGTTTTCTCTGTGTGG + Intergenic
1155384952 18:25267135-25267157 GCAGCTTTGTTTACACTGTGAGG - Intronic
1155395336 18:25380445-25380467 GCAGCTTTATTTACACGGTGAGG - Intergenic
1155665171 18:28299307-28299329 GCAGCTTTGTTTACACTGTGAGG + Intergenic
1155857327 18:30850054-30850076 GTGGTTTTGTTTACACTGTGAGG + Intergenic
1156415126 18:36879811-36879833 CTGGCTTTGTTTACACTCTGAGG + Intronic
1156626859 18:38920033-38920055 CTGGCTTTGTTTACACTGTGAGG + Intergenic
1156979270 18:43265590-43265612 GAGGCTTTGTTTACACTGCGAGG + Intergenic
1157066542 18:44356961-44356983 GTGGCTTTGTTTACACTGTAAGG + Intergenic
1157067285 18:44366728-44366750 GCAGCTTTGTTTACACTGTGGGG + Intergenic
1157071759 18:44416578-44416600 GTGGCTCTGTTTACACTGTGGGG - Intergenic
1157695095 18:49716240-49716262 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1158399024 18:57104258-57104280 GTAGCTTTATTTACACTGTGAGG + Intergenic
1158853392 18:61517978-61518000 GTGGCTTTGTTTACACTGTTAGG - Intronic
1159385956 18:67725816-67725838 GTGTCTTTGTTTACACTGTGAGG + Intergenic
1159581340 18:70237076-70237098 GAGGCTTTGTTTACACTGTGAGG - Intergenic
1159645789 18:70916538-70916560 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1159661219 18:71097906-71097928 TTGGCTTTGTTTACACTGTGAGG + Intergenic
1159690585 18:71482791-71482813 GTGGTTTTGTTTACACTGTGAGG + Intergenic
1159901777 18:74053610-74053632 GTGGCTTTGTTTACACTGTGAGG - Intergenic
1160466641 18:79083187-79083209 GCGGCTTTGTTTACACTGTGAGG + Intronic
1160642066 19:147130-147152 GTGGCTTTGTTTACACAGTGGGG - Intergenic
1161391971 19:4025766-4025788 ACTGATTTTTTTATACTGTGTGG - Intronic
1161953175 19:7478774-7478796 GCTGCCTTGTCTGCTCTGTGTGG + Intronic
1164093055 19:21977940-21977962 GTGGCTTTGTTTATACTCTGAGG - Intronic
1164416652 19:28051217-28051239 GCAGCTTTGTTTACACTGTGAGG - Intergenic
1164979600 19:32603896-32603918 ACGGCTGTGTTCACACTGTGAGG + Intronic
1166263201 19:41657395-41657417 GAGGCTTTGTTTACACTGTGAGG - Intronic
1167974099 19:53210084-53210106 GCAGCTTTGTTTACATTGTGAGG + Intergenic
1168457713 19:56526712-56526734 ATGGCTTTGTTTACGCTGTGAGG - Exonic
924967633 2:92648-92670 GCGGTTTTATTTACACTGTGAGG - Intergenic
925252441 2:2451474-2451496 GTGGCTTTGTTTACACTGTGAGG + Intergenic
925566364 2:5258473-5258495 GCGGCTTTGTTTACACTGTGAGG + Intergenic
925575949 2:5360250-5360272 GTGGCTTTCTTTTCACTGTGGGG - Intergenic
925692359 2:6538036-6538058 GTGGCTTTGTTTACACTGTGAGG - Intergenic
925729146 2:6904936-6904958 GCAGCTTTGTTTGAACTGTGAGG + Intergenic
926508601 2:13745532-13745554 AAGGCTTTGTTTACACTGTGAGG - Intergenic
926533561 2:14082477-14082499 GTGGCTTTGTTTGCACTGTGAGG - Intergenic
926943964 2:18167974-18167996 GCAGCTGTGTTTACACTGTGAGG + Intronic
927117170 2:19916597-19916619 GCGGCTTTGTTTACACTGTGAGG - Intronic
927182801 2:20458964-20458986 GTGGCTTTGTTTACACTGTGAGG - Intergenic
928576699 2:32662959-32662981 GATTCTTTGTTTACACTGTGTGG + Intronic
928750663 2:34466870-34466892 GCAGCTTTGTTTATACTGTGAGG - Intergenic
929062890 2:37941676-37941698 GTGGCTTTGTTTACACCGTGTGG + Intronic
929064732 2:37962473-37962495 GTGGCTTTGTTTACACTGTGTGG + Intronic
929256127 2:39813457-39813479 GTGGCTTTGTTTACACCGTGAGG + Intergenic
929257730 2:39830759-39830781 GCAGCTTTGTTTACACTGTCAGG + Intergenic
929333530 2:40712715-40712737 GAGGCTTTGTTTACACTGTGAGG + Intergenic
930264720 2:49186264-49186286 GCAGCTTTGTTTACACTGTGAGG + Intergenic
930359339 2:50358439-50358461 CGAGCTTTGTTTACATTGTGAGG - Intronic
930476638 2:51891167-51891189 GCGGCTTTGTTTACAGTGTGAGG + Intergenic
930516118 2:52409924-52409946 GGGGCTATGTTTACACTGTGAGG + Intergenic
931004107 2:57828313-57828335 GTGGCTTTGTTTACACTGTGAGG - Intergenic
931030411 2:58168807-58168829 GTGGCATTGTATACACTGTGAGG - Intronic
931538679 2:63304954-63304976 GCAGCTTTGTTTACAACGTGAGG - Intronic
931814844 2:65890311-65890333 GCGGCTTTGTTTACACTGTGAGG - Intergenic
931886690 2:66625763-66625785 GTGGCTTTGTTTACACTGTGAGG + Intergenic
932511794 2:72300304-72300326 GCAGCTTTGTTTACACTGTGAGG + Intronic
932646777 2:73510968-73510990 GCGGCTTTGTTTACACTGTGAGG + Intronic
932899517 2:75681803-75681825 GTGGCTTTGTTTACACTGTGAGG - Intronic
932913899 2:75834349-75834371 GCAGCTTTGTTCACACTGTGAGG - Intergenic
932938944 2:76139493-76139515 GAGGGTTTGTTTACACTGTGAGG + Intergenic
932964132 2:76450614-76450636 GCTTCTTAGTTTATATTGTGAGG + Intergenic
933488270 2:82950327-82950349 GAGGCTTTGTTTACACTGTAAGG + Intergenic
933603189 2:84354304-84354326 GGGGCTTTGTTTACACTGTGAGG - Intergenic
934526375 2:95054376-95054398 TCTGCTTTGTTCCCATTGTGTGG + Intergenic
934906125 2:98205700-98205722 GCTGTTTTGTTTAAAATTTGTGG - Intronic
935104928 2:100032551-100032573 GTTGGTTTGTATACAGTGTGAGG - Intronic
935325850 2:101936027-101936049 GCGGCATTGTTTACACTGTGAGG - Intergenic
935567940 2:104629482-104629504 GTGGCTTTGTTTACACTGTGAGG + Intergenic
935961504 2:108429803-108429825 GTAGCTTTGTTCACAGTGTGAGG - Intergenic
935982833 2:108643875-108643897 GTGGCTTTGTTTACACTGTGAGG - Intronic
936640262 2:114304081-114304103 GTGGCTTTATTTACACTGTGAGG + Intergenic
936769513 2:115894878-115894900 GTGGCTTTGTTTACACTGTGAGG + Intergenic
937143146 2:119618945-119618967 GTGGCTTTGTTTACACTGTGAGG - Intronic
937188446 2:120068565-120068587 GCGGCTTTGTTTATACTGTGAGG - Intronic
937465007 2:122124912-122124934 CTTCCTTTGTTTATACTGTGAGG + Intergenic
937807291 2:126161131-126161153 GTGGCTTTGTTTACATTGCGAGG - Intergenic
937832534 2:126439080-126439102 TCTGCTTTATTTAAATTGTGAGG + Intergenic
937893315 2:126956956-126956978 GGGGCTTTGTTTACACTGTGAGG - Intergenic
938144752 2:128824047-128824069 GCAGCTCTGTTTCCACTGTGAGG - Intergenic
938168114 2:129050316-129050338 GTGGCTTTGTTTACACCGTGTGG + Intergenic
938239088 2:129728960-129728982 GCTGCTGTCTTTACACAGTGGGG - Intergenic
938874411 2:135518040-135518062 GCAGCTTTGTTTACACCGTGAGG + Intronic
938952308 2:136266534-136266556 GGGGCTTTGTTTACACTGTGAGG + Intergenic
939033283 2:137101748-137101770 GCAGCTTTGTTTACACTGTGAGG - Intronic
939116894 2:138071122-138071144 GTGGCTTTGTTTACGCTGTGAGG + Intergenic
939180399 2:138796297-138796319 GCCACTTTGTTTACACTATGAGG - Intergenic
939382030 2:141448197-141448219 GGGACTTTGTTTACACTGTGAGG + Intronic
939640835 2:144638453-144638475 TCGGCTTTGTTTACACTGTGAGG + Intergenic
939652821 2:144785636-144785658 GCAGCTTTGTTTACACTGTGAGG - Intergenic
939876681 2:147586240-147586262 ATGGCTTTGTTTACACTGTGAGG + Intergenic
939937756 2:148313434-148313456 GCAGCTTTGTTTACACTGTGAGG + Intronic
939942015 2:148362344-148362366 ATGGCCTTGTTTACACTGTGAGG - Intronic
939946934 2:148421790-148421812 GCAGCTTTGTTTACACTGTGAGG - Intronic
940030546 2:149257431-149257453 GAGGCTTTGTTTACACTGTGAGG + Intergenic
940114423 2:150192535-150192557 GGCACTTTGTTTACACTGTGAGG - Intergenic
940370570 2:152896235-152896257 ATGGCTTTGTTTACACTGTGAGG - Intergenic
940408077 2:153328587-153328609 GTGGCTTTGTTTACATTGTGAGG + Intergenic
940417812 2:153442828-153442850 GTGGCTTTGTTTGCACTGTGAGG + Intergenic
940593997 2:155766859-155766881 GCAGCTTTGTTTACACTGTGAGG + Intergenic
940602613 2:155880567-155880589 GCGGCTTTGTTTACACTGTGAGG - Intergenic
940757953 2:157704841-157704863 GTGGCTTTGTTTACACTGTGAGG - Intergenic
940821413 2:158360034-158360056 GTGGTTTTGTTTACACTGTGAGG - Intronic
940890973 2:159034920-159034942 ACTGCTTTGACTACAATGTGAGG - Intronic
940925186 2:159356348-159356370 GCAGCTTTATTTACACTGTGAGG - Intronic
940946511 2:159624053-159624075 GCAGCTTTGTTTACACTGTGAGG - Intergenic
940999032 2:160181346-160181368 GTGGCTTTGTTTACACTGTGAGG - Intronic
941045313 2:160668690-160668712 CCTGCTTTATTTGCCCTGTGTGG - Intergenic
941076399 2:161010660-161010682 GTGGCTTTGTTTACACTGTCAGG - Intergenic
941115001 2:161462182-161462204 GCAGCTTTGTTTACACTGTGAGG + Intronic
941119602 2:161513546-161513568 GGGGCTTTGTTTACACGGTGAGG - Intronic
941550055 2:166903852-166903874 GCTGGTTTGTTTCCACTCTTAGG - Exonic
941565341 2:167099287-167099309 GTGGCTTTGTTTACTCTGTGAGG + Intronic
941571498 2:167175899-167175921 GCGGCTTTGTTTACCCTGTGAGG + Intronic
941682322 2:168412824-168412846 GTGGCTTTGTTTACACTGTAGGG + Intergenic
941845303 2:170126262-170126284 GTGGCTTTGTTTACACTGTGAGG - Intergenic
941922933 2:170870136-170870158 GCCGCTTTCTTTAGAATGTGGGG - Intergenic
942010851 2:171761316-171761338 GTGGCTTTGTTTACACTTTGAGG + Intergenic
942199914 2:173560273-173560295 GCAGCTTTGTTTACAATGTGAGG - Intergenic
942229210 2:173844115-173844137 GCTTGTTTGTTTACTCTTTGGGG + Intergenic
942401713 2:175609926-175609948 TTTGCTTGGTTCACACTGTGAGG + Intergenic
942411050 2:175709477-175709499 GTGGCTTTGTTTACACTGTGGGG - Intergenic
942732602 2:179076262-179076284 GCAGGTCTGTTTACACTGTAAGG - Intergenic
942898763 2:181089578-181089600 GGAGCTTTGTTTACACTGTGAGG - Intergenic
942953673 2:181750320-181750342 GTGGCTTTGTTTACACTGTGAGG + Intergenic
943074633 2:183179321-183179343 GTTGCTTCCTTAACACTGTGTGG + Intergenic
943084984 2:183300585-183300607 GTGGCTTTGTTTACACTGTGAGG + Intergenic
943105719 2:183543903-183543925 GCTGCTTTGTTTACACTGTGAGG - Intergenic
943112335 2:183621737-183621759 GTGGCTTTGTTTGCACTGTGAGG + Intergenic
943129977 2:183842238-183842260 GCAGCTTTGTTTACACTGTGAGG - Intergenic
943352533 2:186812446-186812468 GTGGCTTTGTTTTCACTGTGAGG - Intergenic
943408752 2:187519929-187519951 GGGGCTTTGTTTACACTGTGAGG + Intronic
943409808 2:187532938-187532960 GGGGCTTTGTTTACACTGTGAGG - Intronic
943512322 2:188840978-188841000 GTGGGTTTGTTTACACTGTGAGG - Intergenic
943552472 2:189357497-189357519 GTGGCTTTGTTTACACTGTGAGG + Intergenic
943599130 2:189893015-189893037 GTGGCTTTGTTTACACTGTGAGG + Intronic
943660495 2:190554514-190554536 GTGGCTTTGTTTACACTGTGAGG - Intergenic
944292048 2:198018589-198018611 GCGGCTTTGTTTACACTGTGAGG - Intronic
944347402 2:198685150-198685172 GTGGCTTTGTTTACACTGTGGGG - Intergenic
944607939 2:201369975-201369997 GCAGCTTTGTTTACACTGTGAGG - Intergenic
945207235 2:207344815-207344837 GTGGCTTTGTTTACACTGTGAGG - Intergenic
945329716 2:208525310-208525332 GTGGCTTTGTTTACACTGTGAGG + Intronic
945409188 2:209488646-209488668 GCAGCTTTGTTTACACTGTGAGG - Intronic
945467055 2:210181674-210181696 GTGGCTTTGTTTACACTGTGAGG - Intergenic
945486884 2:210406976-210406998 ATGGCTTTGTTTACACTGTGAGG + Intergenic
945628236 2:212237859-212237881 GTGGCTTTGTTTACACTGTGAGG + Intronic
945662888 2:212708197-212708219 ACTGCTTTCTTTAGAATGTGGGG - Intergenic
945799490 2:214409429-214409451 CCTGATTTGTTTTCACTTTGAGG + Intronic
945885385 2:215370511-215370533 TTTGCTTTGTTTAAACAGTGAGG - Intronic
945927419 2:215819683-215819705 GCAGCTTTGTTTACCCTGTGAGG - Intergenic
945945210 2:215988752-215988774 GCGGCTTTGTGTACACTGTGAGG - Intronic
946065302 2:216982486-216982508 GTGACTTTGTTTACACTGTGAGG + Intergenic
946913010 2:224485481-224485503 GAGGCCTTGTTTACACTGTGAGG - Intronic
947086058 2:226454301-226454323 GTGGCTTTGTTTACACTGTGAGG - Intergenic
947225835 2:227839469-227839491 GAAGCTTTGTTTTCACTGTGAGG + Intergenic
947258912 2:228198703-228198725 GCTGCCTTGTGTGTACTGTGCGG + Intergenic
947364696 2:229381636-229381658 GCGGCTTTGTTTACACTGTGAGG - Intronic
947492133 2:230604000-230604022 GTGGCTTTGTTTACACTGTGAGG - Intergenic
947681409 2:232037318-232037340 GTGGCTTTGTTTACACTGTGAGG + Intronic
948111307 2:235458283-235458305 GCTGCTTTGCTTGCTCTGGGAGG + Intergenic
948899568 2:240949525-240949547 GCTGCTCCATTTCCACTGTGGGG - Intronic
1169320035 20:4625105-4625127 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1169397035 20:5241501-5241523 GCGGCTTTATTTACACTGTGAGG + Intergenic
1169712072 20:8575684-8575706 TCTGATTTGTTTGCACTGTAAGG + Intronic
1169960330 20:11152542-11152564 GCAGCTTTGTTTACACTGTGAGG + Intergenic
1170133921 20:13052750-13052772 ACTGCTTTGTTTACACTGTGAGG - Intronic
1170167882 20:13380858-13380880 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1170229376 20:14028194-14028216 GGCGCTTTGTTTACACTGTAAGG + Intronic
1170454613 20:16520387-16520409 GCGGCTTTGTTTACACTGTGAGG - Intronic
1170720433 20:18873182-18873204 GCAGCTTTGTTAACACTATGAGG + Intergenic
1170727324 20:18941633-18941655 GCGTCTTAGTTTACACTATGAGG + Intergenic
1171441404 20:25166295-25166317 GTGGCTTTGTTTACACTGTGAGG - Intergenic
1171513385 20:25706484-25706506 ATGGCTTTGTTTACACTCTGAGG + Intergenic
1171883484 20:30634571-30634593 GCTGCTGGCTTAACACTGTGTGG + Intergenic
1172466844 20:35161634-35161656 GCAGCTTTGTTTACACTGTGAGG - Intergenic
1173751149 20:45477942-45477964 GTGGCTTTGTTTACTCTGTGAGG + Intronic
1174187509 20:48717113-48717135 GCAGCTTTGTTTTCACACTGTGG - Intronic
1175040963 20:56050225-56050247 GCGGCTTTGTTTACACTGTGAGG - Intergenic
1176820458 21:13650973-13650995 GCTGCTCTGTTTTCTCTGTGTGG - Intergenic
1176857348 21:13983798-13983820 GCTGCACTTTTCACACTGTGGGG + Intergenic
1176891797 21:14327524-14327546 ACAGCTTTGTTTACACTGTGAGG - Intergenic
1177050288 21:16224961-16224983 GTGGCTTTGTTTACACTGTGAGG - Intergenic
1177129679 21:17240829-17240851 GCAGCTTTGTTTACACTGTAAGG - Intergenic
1177136388 21:17308975-17308997 GTGGGTTTGTTTACACTGTGAGG - Intergenic
1177184178 21:17775523-17775545 GAGGCTTTGTTTACACTATGAGG + Intergenic
1177313247 21:19424522-19424544 GCAGCTTTGTTTACATTGTAAGG - Intergenic
1177541007 21:22493855-22493877 GTGGCTTTGTTTATACTGTCAGG - Intergenic
1177566304 21:22826808-22826830 GCTGTTTTGCTTTCACTGTTAGG + Intergenic
1178007115 21:28234401-28234423 GTGGCTTTGTTTACACCGTGAGG - Intergenic
1178379221 21:32093991-32094013 CCTGCTTTTTTGACATTGTGAGG + Intergenic
1178393577 21:32219834-32219856 AAGGCTTTGTTTACACTGTGAGG - Intergenic
1178864435 21:36316456-36316478 GCAGTTTTGTTTACACTGTGAGG + Intergenic
1179827488 21:43974808-43974830 GCTTCTTTGTCTACAGTGAGGGG - Intronic
1180596249 22:16975368-16975390 GAGGGTTTGTTTACACTATGAGG - Intronic
1182204500 22:28609946-28609968 GTGGCTTTGTTTACACTGTGAGG - Intronic
1182890987 22:33818713-33818735 TCTGCTTTGTTTTCATTGTTCGG - Intronic
1182952476 22:34390592-34390614 GCTGCTTTGTTTACATTGTGAGG + Intergenic
1183021479 22:35030725-35030747 TCGGCGTTGTTTACGCTGTGAGG + Intergenic
1184567687 22:45302115-45302137 CCTGTTTTGTTTCCAGTGTGGGG + Intergenic
949155025 3:816859-816881 GCAGCTTTGTTCACTCTGTAAGG - Intergenic
949173865 3:1034904-1034926 GTTGCTTTGTTTACACTGTGAGG + Intergenic
949377669 3:3407928-3407950 GCGGCTTTGTTTACACTGTGAGG - Intergenic
949517320 3:4819514-4819536 TCTGCTTTGTCTCCTCTGTGAGG - Intronic
949519331 3:4835521-4835543 GTTGCTTTGTGTACACCGTGGGG - Intronic
949580593 3:5384057-5384079 GTGGCTTTGTTTACACTGTGAGG + Intergenic
949583378 3:5412879-5412901 GCAGCTTTGTTTACAATGTGAGG - Intergenic
949594576 3:5530755-5530777 GCGGCTTTGTTTATGCTCTGAGG + Intergenic
949846104 3:8372263-8372285 GCAGCTTTATTTACACTGTGAGG - Intergenic
950484749 3:13266526-13266548 GCTGCTCTGTGCACGCTGTGTGG - Intergenic
950561968 3:13736157-13736179 GCGGCTTTGTTTACACTGTGAGG + Intergenic
950597441 3:13997061-13997083 AGCGCTTTGTTTACACTGTGAGG + Intronic
950612028 3:14132962-14132984 GCAGCTTTGTCTACACTGGCAGG + Intronic
951237701 3:20254469-20254491 GGTACTCTGTTTACATTGTGAGG + Intergenic
951254484 3:20432907-20432929 GAGGCTTTGTTTACACTGTGAGG + Intergenic
951310922 3:21125215-21125237 ATGGCTTTGTTTATACTGTGAGG - Intergenic
951347218 3:21560928-21560950 GTGGCTTTGTTTACACTGTGAGG + Intronic
951415117 3:22414324-22414346 GTGGCTTCCTTTACACTGTGAGG + Intergenic
951434250 3:22643385-22643407 GAGCCTTTGTTTACACTGTGAGG + Intergenic
951503658 3:23417838-23417860 GCGATTTTGTTTACACTGTGAGG + Intronic
951618514 3:24575036-24575058 GTTTATTTGTTTACACTTTGTGG - Intergenic
951629107 3:24699250-24699272 AAGGCTTTGTTTACACTGTGAGG + Intergenic
951741687 3:25931828-25931850 GCAGCTTTGTTTATGCTGTGAGG - Intergenic
951777236 3:26323854-26323876 GTGGCTTTGTTTACACTGTAAGG + Intergenic
951795475 3:26533783-26533805 CTTTGTTTGTTTACACTGTGAGG + Intergenic
951826685 3:26876196-26876218 GCAGCTTTGTTTACCCTGTGAGG - Intergenic
951930683 3:27963633-27963655 GCTGCTTTCTTTTCCCTCTGAGG + Intergenic
952098598 3:29985162-29985184 GCAGCTTTGTTTACACTGTGAGG + Intronic
952763195 3:36933732-36933754 TTTGCTTTGTTTACCCAGTGAGG + Intronic
953047253 3:39304889-39304911 GAGGCTTCGTTTACACTGTGAGG - Intergenic
953315882 3:41925762-41925784 GTGGCTTTGTTTATGCTGTGAGG - Intronic
953433362 3:42857881-42857903 GTGGCTTTGTTTACACTGCGAGG - Intronic
953555770 3:43945841-43945863 GTGGCTTTGTTTACACTGTGAGG + Intergenic
954490610 3:50901255-50901277 ATGGCTTTGTTTACACTGTGAGG + Intronic
954510487 3:51120747-51120769 GTGACTTGGTTTACACTGTGAGG + Intronic
954531091 3:51320684-51320706 GTGGCTCTGTTTCCACTGTGAGG - Intronic
954863642 3:53711067-53711089 GCTTCTTTGTTTACAATTTTTGG - Intronic
954950544 3:54468787-54468809 GCAGCTTTGTTTACACTGTGAGG - Intronic
955175092 3:56606053-56606075 GCCGCTTTGTTTACACTATGAGG + Intronic
955414280 3:58678378-58678400 TCCCCTTTGTTTACACTGTGAGG + Intergenic
955439769 3:58942933-58942955 GTGGCTTTGTTTTCACTGTGAGG - Intronic
955447820 3:59032556-59032578 GTGGCTTTGTTTTCACTGTGAGG - Intronic
955657814 3:61263590-61263612 AAGGCTTTGTTTACACTGTGAGG + Intergenic
956005828 3:64777146-64777168 GCAGCTTTGTTTATACTTTGAGG - Intergenic
956157319 3:66312264-66312286 GCAGCTTTGTTTACACTGTGAGG + Intronic
956207709 3:66771604-66771626 ATGGCTTTGTTTACACTGTGAGG + Intergenic
956220102 3:66893385-66893407 GTGGCTTTGTTTACACTGTGAGG - Intergenic
956243421 3:67154631-67154653 GCGGCTTTGTTTACACTGTGGGG - Intergenic
956355734 3:68390213-68390235 GAGGCTTTGTTTACACTGTGAGG - Intronic
956383054 3:68686236-68686258 GCCAGTTTGTTTACACTGTGAGG + Intergenic
956398107 3:68847299-68847321 GCCACTTTGTTTACACTGTTAGG + Intronic
957011220 3:75008350-75008372 GTTGCTTTGTTTACACTGTGAGG + Intergenic
957249679 3:77757103-77757125 GAGGCTTTGTTTACACTGTGAGG - Intergenic
957474855 3:80709790-80709812 GTGGCTTTGTTTACACTGTGAGG - Intergenic
957695730 3:83636072-83636094 GTGGCTTTGTTAAAACTGTGAGG - Intergenic
957747668 3:84366047-84366069 GTGGTGTTGTTTACACTGTGAGG + Intergenic
957776507 3:84761369-84761391 GCAGCTTTATTCACACTGGGAGG - Intergenic
957850432 3:85800167-85800189 GAGGCTTTGTTTACATTGTGAGG + Intronic
957993242 3:87653654-87653676 GTGGCTTTGTTTACACTGTGAGG + Intergenic
958257449 3:91341170-91341192 GCAGCTTTGTTTACATTGTGAGG + Intergenic
958434510 3:94080685-94080707 ATGGCTTTGTTTACACTGTGAGG + Intronic
958520900 3:95184534-95184556 GTGTCCTTGTTTACACTGTGAGG + Intergenic
958586257 3:96091550-96091572 TAGGCTTTGTTTACACTGTGAGG - Intergenic
958694555 3:97510970-97510992 GCAGCTTTGTTTACACTGTGAGG + Intronic
958793596 3:98682230-98682252 GTGGCTTTGTTTACACTGTGAGG - Intergenic
958876100 3:99619140-99619162 GCTTCTTTGTTTATACTGCTAGG - Intergenic
958949781 3:100403799-100403821 TCTGCTTTCTTTATAATGTGAGG + Intronic
959025661 3:101237075-101237097 GCGGCTTTATTTACACTGTGAGG - Intronic
959074562 3:101736054-101736076 GAGATTTTGTTTACACTGTGAGG - Intronic
959091802 3:101911236-101911258 GTGGTTTTGTCTACACTGTGAGG + Intergenic
959278224 3:104304658-104304680 GTGGCTTTGTTTACACTGTGAGG - Intergenic
959291901 3:104485307-104485329 GCAGCTTTGTTTACACTGTGAGG - Intergenic
959534622 3:107470720-107470742 GTGGCTTTGTTTACACTGTGAGG - Intergenic
959801009 3:110495376-110495398 GTGGCTTTGTTTACACTGTGAGG - Intergenic
959848087 3:111057017-111057039 GGGGCTTTGTTTACACTGTAAGG - Intergenic
959881187 3:111446888-111446910 GTGGCTTTGTTTATACTGTGAGG + Intronic
960177297 3:114532346-114532368 GTGGCTTTGTTTTCACTGTGAGG - Intronic
960768650 3:121167536-121167558 GTGGCTTTGTTTACACTCTGAGG - Intronic
960773142 3:121216964-121216986 GTGGCTTTGTTTATACTGTCAGG + Intronic
961310602 3:125996940-125996962 GTGGCTTTGTTTACACTGTGAGG - Intergenic
961998236 3:131269049-131269071 GCAGCTTTGTTTACACTATGAGG + Intronic
962074690 3:132069179-132069201 CATGCTTTATTTACACTGTAAGG - Intronic
962156875 3:132957079-132957101 GTGGCTTTGTCTACACAGTGAGG - Intergenic
962181094 3:133207085-133207107 GTGGCTTTGTTTACAATGTGAGG + Intronic
962512359 3:136114643-136114665 AGTGCTTTGTTTACACTGTGAGG - Intronic
962634765 3:137319368-137319390 TCGGCTTTGTTTACACTGTGAGG + Intergenic
962640122 3:137377086-137377108 GTGGCTTTGTTTACACTGTGAGG + Intergenic
962666061 3:137654570-137654592 GCAGCTTTGTTTATACTGTGAGG - Intergenic
962668406 3:137679703-137679725 GTGGCTTCGTTTACACTGAGAGG - Intergenic
963013951 3:140803067-140803089 GCAGCTTTGTTTACACTGTGAGG + Intergenic
963027458 3:140933747-140933769 GCAGCTTTGTTTACACTGTGAGG - Intergenic
963529465 3:146455911-146455933 TCTTCTTTGTTTGCACTGTTTGG + Intronic
963629281 3:147712942-147712964 GCAGTTTTGTTTACACTGTGAGG + Intergenic
963898676 3:150712501-150712523 GTGGCTTTGTTTACACTGTGAGG - Intergenic
963976332 3:151484158-151484180 GCGGCTTTGTTTATACTGTGAGG - Intergenic
963980255 3:151529061-151529083 GCAGCTTTGTTTACACTGTGAGG - Intergenic
964010382 3:151885500-151885522 GCAGCTTTGTTTACACTGTGAGG - Intergenic
964049469 3:152373080-152373102 GAAGCTTTGTTTATACTGTGAGG + Intronic
964053111 3:152419964-152419986 GCAGCTTGGTTTACATCGTGAGG - Intronic
964053313 3:152421521-152421543 GCGGCTTTGTTTACACTGTTTGG - Intronic
964371352 3:156003869-156003891 GTGGCCTTGTTTACACTGTGAGG + Intergenic
964649078 3:158991339-158991361 GTGGCTTTGTTTACATTGTAAGG + Intronic
964904849 3:161707443-161707465 GTGGCTTTGTTTACACAGTGAGG - Intergenic
965017420 3:163175072-163175094 GCAGCTTTGTTTACACTGTGAGG - Intergenic
965025512 3:163297125-163297147 GTGGCTTTGTTTACAGTGTGAGG - Intergenic
965091055 3:164163206-164163228 GAGGCTTTGTTTACAATGTGAGG + Intergenic
965293171 3:166909675-166909697 GTGGTTTTGCTTACACTGTGAGG + Intergenic
965324774 3:167289944-167289966 GCAGCTTTGTTTACACTGTGAGG - Intronic
965497278 3:169413745-169413767 GTGGCTTTGTTTACACTGTGAGG - Intronic
965511123 3:169568577-169568599 GTGGCTTTGTTTACACTGTGAGG - Intronic
965618717 3:170621436-170621458 GTGGCTTTGTTTACACTGTGAGG + Intronic
965880464 3:173382510-173382532 CCAGCTTTGTTTACACTGGGAGG - Intergenic
966084327 3:176049722-176049744 TCTGCTCTGTTTACATCGTGTGG - Intergenic
966255095 3:177908460-177908482 GCAGTTTTGTTTACACTGTGAGG + Intergenic
966255150 3:177908830-177908852 GCAGTTTTGTTTACACTGTGAGG - Intergenic
966309424 3:178576701-178576723 GTGGCTTTGTTTACACTGTGAGG - Intronic
966493736 3:180556650-180556672 GCGGCTTTGTTTACACTGTGAGG - Intergenic
966533287 3:181004288-181004310 GCGACTTTGTTTATACTGTGAGG + Intergenic
966561439 3:181325019-181325041 GGGGCTTTGTTTACACTGTGAGG + Intergenic
966637901 3:182156488-182156510 GTGGCTTTGTTTACACTGTGAGG + Intergenic
967181485 3:186909318-186909340 GCGGTTTTGTTTACACTGTGAGG + Intergenic
967419557 3:189258785-189258807 GTGGCTTTGTTTACACTGTGAGG + Intronic
967562651 3:190934793-190934815 GCAGCTTTGTTTACACTGTAAGG + Intergenic
967638620 3:191834819-191834841 GGGGCTTTGTTTACACTGTGAGG - Intergenic
967846664 3:194048583-194048605 GTTTCTTTGGTTACAGTGTGAGG - Intergenic
968829088 4:2922919-2922941 GCAGCTTTGTTTACACTGTGAGG + Intronic
969164801 4:5298567-5298589 GTGGCTTTGTTTACACTGTGAGG + Intronic
969909177 4:10427853-10427875 GTGGCTTTGTTTACACCGTGAGG + Intergenic
970304728 4:14719300-14719322 GAGGCTTTGTTTACACTGTGAGG - Intergenic
970685259 4:18559776-18559798 GCAGCTTTGTTTACACTCTGAGG - Intergenic
970727189 4:19060499-19060521 GAGGCTTTGCTTACACTGTGAGG - Intergenic
971004507 4:22357906-22357928 GCAGCTTTGTTTGCACTGTTAGG - Intronic
971279144 4:25226956-25226978 TTGGCTTTGTTTACACTTTGGGG - Intronic
971430049 4:26556303-26556325 GTGGCTTCGTTTACACTGTGAGG + Intergenic
971647695 4:29229973-29229995 GCAGCTTTGTTTAAACTGTGTGG - Intergenic
972219334 4:36935975-36935997 GTGGCTTTGTTTACACTGTGAGG - Intergenic
972743261 4:41909290-41909312 GCAGCTTTGTTTACACTATGAGG + Intergenic
972755580 4:42042431-42042453 ATGGCTTTGTTTACACTGTGAGG - Intronic
973081842 4:46003056-46003078 GTGGCCTTGTTTATACTGTGAGG + Intergenic
973273017 4:48280272-48280294 GTGGCTTTGTTTACACTGTGAGG - Intergenic
973562653 4:52151856-52151878 GTGGCTTTGTTTACACTGTGAGG - Intergenic
973660919 4:53105545-53105567 GTGGCTTTGTTTACACTGTTAGG - Intronic
973715208 4:53669599-53669621 GTGGCTTTGTTTACACTTTGAGG + Intronic
973798406 4:54451560-54451582 GTGGCTTTGTTTATACTGTGAGG - Intergenic
973837505 4:54825058-54825080 GCGTCTTTGTTTACACTGTGAGG - Intergenic
974161764 4:58149910-58149932 GCAGCTTTGTTTACACTGTGAGG - Intergenic
974251766 4:59394288-59394310 GAGGCTTTTTTCACACTGTGAGG + Intergenic
974263965 4:59560387-59560409 GCAGCTTTGTTTACACTGTGAGG + Intergenic
974265735 4:59584013-59584035 GTGGCTTTGTTTACGCTGTGAGG + Intergenic
974307083 4:60156140-60156162 GCAGCTTTGTTTACACTGTGAGG + Intergenic
974326288 4:60419142-60419164 GCAGCTTTGTTTACACTGTGAGG + Intergenic
974453296 4:62094127-62094149 GCGGCTTTGTTTACACTGTGAGG + Intergenic
974793013 4:66714254-66714276 GGGGCTTTGTTTACACTGTGAGG - Intergenic
974851770 4:67412500-67412522 GTGGCTTTGTTTACACTGTGAGG + Intergenic
974928468 4:68331716-68331738 GATGCTTGATTTACACTTTGAGG - Intronic
975096651 4:70464606-70464628 GTGGCTTTTTTTACACTGTGAGG - Intronic
975104129 4:70548956-70548978 GCGGCTTTATTTATACTATGAGG - Intergenic
975149395 4:71004740-71004762 GTGGTTTTGTTTACACTGTGAGG + Intronic
975367374 4:73544812-73544834 GTGTCTTTGTTTACACTGTGAGG - Intergenic
975424962 4:74214977-74214999 GTGGCTTTGTTTACACTGTGAGG + Intronic
975466329 4:74713742-74713764 GTGGCTTTGTTTACATGGTGAGG + Intergenic
975484160 4:74915974-74915996 GCAGCTTTGTTTACATTGTGAGG + Intergenic
975524265 4:75331659-75331681 GTGGCTTTGTTTACACTGTGAGG - Intergenic
975533045 4:75420714-75420736 CTGGCTTTGTTTACACTGTGAGG + Intergenic
975638802 4:76478336-76478358 GTGGCTTTGTTTACACTGTGAGG - Intronic
975764701 4:77655104-77655126 GCGGCTTCGTTTACACTGTGAGG - Intergenic
976061246 4:81130765-81130787 GCGGCTTTGTTTACACTGTAAGG + Intronic
976065566 4:81183852-81183874 GCAGCTTTGTTTTCACTATGAGG - Intronic
976114864 4:81715597-81715619 GCGGCTTTGTTTACAATGTGAGG - Intronic
976370823 4:84286291-84286313 GCGGCTTTGTTTACACTTTTAGG - Intergenic
976394925 4:84545312-84545334 GAGGCTTTGTTTACACTGTGAGG - Intergenic
976438307 4:85044004-85044026 GCAGCTTTGTTTACACTGTAAGG - Intergenic
976439291 4:85055126-85055148 GTGGTTTTGTGTACACTGTGAGG - Intergenic
976445965 4:85129897-85129919 GAGGCTTTGTTTACACTGTGAGG + Intergenic
976534314 4:86193534-86193556 GCATCTTTGTTTACACTGTGAGG + Intronic
976546950 4:86346768-86346790 ACAGCTGTGTTTAAACTGTGTGG - Intronic
976669518 4:87636533-87636555 GCGGCTTTGTTTACACTGTGAGG - Intergenic
976715953 4:88122521-88122543 GAGGCTTTGTTTACACTGTGAGG - Intronic
976809922 4:89089808-89089830 GCAGCTTTGTTTACGCTTTTAGG + Intronic
977123610 4:93135919-93135941 ACTGCTTTTTATAAACTGTGTGG + Intronic
977154487 4:93555467-93555489 GAAGCTTTGTTTACACTGTGAGG - Intronic
977185641 4:93932585-93932607 GTGGCTTTGTTTACACTGTGAGG + Intergenic
977438958 4:97037877-97037899 GTGGCTTTGTTTATACTGTGAGG + Intergenic
977467746 4:97403139-97403161 GGGGCTTTGTTTACACTGTGAGG + Intronic
977631461 4:99247980-99248002 GCAGCTTTGTTTACAATGTGAGG + Intergenic
977632968 4:99263597-99263619 GCAGCTTTGTTTACACTGTGAGG + Intergenic
977671405 4:99699429-99699451 GTGCCTTTGTTTACACTGTGAGG - Intergenic
977723470 4:100267555-100267577 GCAGCTTTGTTTACACTGTGAGG + Intergenic
977774440 4:100900804-100900826 GCGGCTTTGTTTCCACTGTGAGG - Intergenic
977792949 4:101129106-101129128 TGGGCTTTGTTTACACTGTGAGG - Intronic
977986191 4:103385754-103385776 GTGGCTTTGTTTACACTGTGAGG - Intergenic
978090302 4:104707211-104707233 GCAGCTTTGTTTACACTGTGAGG - Intergenic
978108283 4:104930918-104930940 GCCGCTTTGTTTACACTGTGAGG - Intergenic
978139081 4:105297304-105297326 GAAGCTTTGTTTACACTGTGAGG - Intergenic
978179522 4:105776126-105776148 GTGGCTTTGTTTATACTGCGAGG + Intronic
978186044 4:105858191-105858213 GCGGCTTTGTTTACATTGTGAGG + Intronic
978247229 4:106588355-106588377 GCTGATTTGGGTACACAGTGAGG + Intergenic
978313292 4:107409649-107409671 GCAGCTTTGTTTATACTGTGAGG - Intergenic
978601402 4:110431947-110431969 GTGGCTTTGTTTACACTGTGAGG + Intronic
978699754 4:111628234-111628256 GTTGCTTTGATTACACTATGAGG + Intergenic
979417469 4:120461014-120461036 TTGGCTTTGTCTACACTGTGAGG - Intergenic
979421406 4:120509471-120509493 GTGGCTTTGTTTATGCTGTGAGG - Intergenic
979457610 4:120944427-120944449 GTGGCTTTGTTTACACTGTGAGG - Intergenic
979461598 4:120990477-120990499 GTGGCTTTGTTTACACTGTGAGG + Intergenic
979588248 4:122446086-122446108 GTGGCTTTGTTTACACTGTGAGG + Intergenic
979668264 4:123336466-123336488 GCAGCTTTGTTTACACTATGAGG + Intergenic
979698281 4:123639039-123639061 GGGGCTTTGTTTACACTGTGAGG + Intergenic
979965963 4:127077120-127077142 GCAGCTTTGTTTACACTGTGAGG + Intergenic
979998697 4:127463933-127463955 GTGACTTTGTTTACACTGTGAGG + Intergenic
980157620 4:129126303-129126325 GTGGCTTTGTTTACTCTGTGAGG + Intergenic
980223294 4:129947747-129947769 GCGGCTTTCTTTACACTGTGAGG + Intergenic
980330372 4:131403366-131403388 GAGACTTTGTTTACACTGTGAGG + Intergenic
980494158 4:133570082-133570104 GCAGCTTTGTTTAAACTGTGAGG + Intergenic
980583628 4:134786387-134786409 GCGCCTTTGTTTACACTGTGAGG + Intergenic
980633912 4:135473732-135473754 GGGGCTTTGTGTACACTGTGAGG + Intergenic
980769340 4:137351237-137351259 GGGGCTTTGTTTACACTGTGAGG - Intergenic
981049134 4:140293695-140293717 GCACCTTTGGATACACTGTGGGG - Intronic
981123707 4:141081867-141081889 GCTGTTTTGTTTATACCCTGTGG + Intronic
981131593 4:141163161-141163183 GTGGCTTTGTTTACACTGTGAGG - Intronic
981133968 4:141189680-141189702 GTGGCTGCGTTTACACTGTGAGG + Intronic
981273190 4:142868079-142868101 GCAGCTTTGTTTACACTGTGAGG - Intergenic
981296672 4:143140721-143140743 GTGGCTTTGTTTACACTGTGAGG - Intergenic
981411267 4:144435287-144435309 GTGGCTTTGTTTACACTGTGAGG - Intergenic
981481460 4:145243277-145243299 GTGGCTTTGTTTATACTGTGAGG + Intergenic
981629709 4:146804593-146804615 GAGGCTTTCTTTACACTGTGAGG - Intronic
981662530 4:147184241-147184263 GCACCTTTGTTTACACTGTGAGG - Intergenic
981671554 4:147292818-147292840 ATGGCTTTGTTTACACTGTGAGG - Intergenic
981749874 4:148082935-148082957 GTGGCTCTGTTTACACTGGGAGG - Intronic
981787974 4:148502681-148502703 GCATCTTTGTTTACACTGTGAGG + Intergenic
981789618 4:148521688-148521710 GCAGCTTTGTTTACACTATGAGG + Intergenic
981794928 4:148585377-148585399 GTGGCTTTGTTTACACTGTGAGG + Intergenic
981850992 4:149229868-149229890 GCTGCTTTGTTTACACTGTAAGG - Intergenic
981859838 4:149341317-149341339 GTGGCTTTGTTTACACTGTGAGG + Intergenic
981885347 4:149666785-149666807 GCAGCTTTGTTTACACTGTGAGG - Intergenic
981939979 4:150271717-150271739 GAGGCTTTGTTTACACCGTGAGG - Intronic
982060262 4:151597811-151597833 GTGACTTTGTTTATACTGTGAGG + Intronic
982209426 4:153022561-153022583 GCTGCTGTGCTTGCCCTGTGTGG + Intergenic
982298948 4:153859513-153859535 GTAGTTTTGTTCACACTGTGGGG + Intergenic
982323889 4:154109140-154109162 GCGACTTTGTTTACACTGTGAGG - Intergenic
982725593 4:158902768-158902790 GCAGCTTTGTTTACACTGTGAGG + Intronic
982733262 4:158979133-158979155 GAGACTTTGTTCACACTGTGAGG + Intronic
982733430 4:158980063-158980085 GAAGCTTTGTTTACACTGTGAGG - Intronic
982794527 4:159629508-159629530 GTGGCTTTGTTTACACTGTGAGG + Intergenic
982852946 4:160342256-160342278 GTGGCTTTGTTTACATTGTGAGG + Intergenic
982909208 4:161118029-161118051 GAGGCTTTGGTTACACTGTAAGG + Intergenic
983044506 4:162969644-162969666 GTGGCTTTGTTTGCACTGTGAGG + Intergenic
983047465 4:163004501-163004523 GCAGCTTTGTTTACACTGTGAGG + Intergenic
983179460 4:164630800-164630822 GTGGCTTTGTTTACACTATGAGG - Intergenic
983299020 4:165902026-165902048 GCATGTTTGTTTACACTGTGAGG + Intronic
983602730 4:169548750-169548772 GTGGCTTTGTTTACACCATGAGG + Intronic
983731767 4:171003129-171003151 GCTGTTATGTTTTCACAGTGTGG + Intergenic
983896211 4:173084595-173084617 GCAGCTTTGTTTACACTGTGAGG + Intergenic
983958795 4:173727729-173727751 GTGGCTTTTTTTACACTGTGAGG + Intergenic
984269815 4:177536893-177536915 GAGGCTTTGTTTACACTGTGAGG + Intergenic
984354213 4:178637341-178637363 AGGGCTTTGTTTACACTGTGAGG - Intergenic
984493690 4:180468784-180468806 GCGGCTTTGTTTACACTGTGGGG - Intergenic
984526042 4:180860516-180860538 GGGGCTTTGTTTACACTGTGAGG + Intergenic
984618656 4:181927381-181927403 GCGGCTTTATTTACACTGTGAGG - Intergenic
984902965 4:184601039-184601061 CGAGCTCTGTTTACACTGTGAGG - Intergenic
985619738 5:947974-947996 GCTTCTTTCTTCACACTGCGAGG + Intergenic
986110367 5:4709998-4710020 GTGGCTTTGTTTACATGGTGAGG - Intergenic
986323054 5:6649389-6649411 GGGGCTTTGTTTACACTATGAGG + Intronic
986378820 5:7162585-7162607 GTGGCTTTGTTTACACCGTGAGG + Intergenic
986484357 5:8220369-8220391 GTGGCTTTGTTTACATTGTGAGG - Intergenic
986581669 5:9272227-9272249 GTGGCTTTGTTTACACTGTGAGG - Intronic
986664978 5:10093919-10093941 GTGGATTTGTTTACACTGTGAGG - Intergenic
986675199 5:10178017-10178039 GTGGCTTTGTTTATGCTGTGAGG - Intergenic
986838824 5:11672554-11672576 GCAGGCTTGTTTACACTGTGAGG + Intronic
986879600 5:12153859-12153881 GTGGCTTTGTTTACACTGTGAGG - Intergenic
987019277 5:13852728-13852750 GCGGCTTTGTTAACACTGTGAGG - Intronic
987524680 5:19031900-19031922 GCTGCTTTTTTTCCTGTGTGTGG - Intergenic
987656541 5:20814988-20815010 GTGGTTTTGTTTACACTGAGGGG - Intergenic
987704606 5:21446799-21446821 GGGGCTTTGTTTACACTGAGAGG + Intergenic
987720557 5:21627686-21627708 AAGGCTTTGTTTACCCTGTGAGG + Intergenic
987924069 5:24317749-24317771 GCAGCTTTGTTTACACTGTGAGG + Intergenic
988047625 5:25977861-25977883 TTTGCTTTGTTTAAACTGTTAGG + Intergenic
988289820 5:29270695-29270717 GTGGCTTTGTTTACACTGTGAGG - Intergenic
988618230 5:32795367-32795389 GTGGCTTTGTTTACACTGTGAGG - Intergenic
988628008 5:32898648-32898670 GCAGCTTTGTTTACACTGTGAGG + Intergenic
988719225 5:33859367-33859389 GCAGCTTTGTTTACACTGTGAGG - Intronic
988767015 5:34388957-34388979 GTGGTTTTGTTTACACTGAGGGG + Intergenic
989084066 5:37656728-37656750 GTGGCTTTGTTAAAACTGTGAGG + Intronic
989194180 5:38699993-38700015 GCAGCTTTGTTTACACTGTGAGG - Intergenic
989675231 5:43965723-43965745 GCAACTTTGTTTACACTGTGAGG + Intergenic
989687613 5:44108315-44108337 GTGGCTTTGTTTACACTGTGAGG + Intergenic
989825348 5:45848142-45848164 GCTGCTTTGTTTACACTGTGAGG - Intergenic
989958893 5:50387398-50387420 GTGGCTTTGTTTACACTGTGGGG - Intergenic
990098867 5:52157001-52157023 GAGGTTTTGCTTACACTGTGAGG - Intergenic
990164324 5:52977693-52977715 GTAACTTTGTTTACACTGTGTGG + Intergenic
990183757 5:53191116-53191138 GTGGCTTTGTTTACACTGTGAGG + Intergenic
990224275 5:53631657-53631679 GCAGCATTGTTTACACTGTAAGG + Intronic
990673868 5:58162101-58162123 GTGGCTTTGTTTACACTGTGAGG + Intergenic
990745841 5:58958869-58958891 TTGGCTTTGTTTACACTGTGAGG + Intergenic
990803519 5:59632101-59632123 GCAGCTTTGTTTACACTGTGAGG - Intronic
990837814 5:60042165-60042187 GTGGCTTTGTTTACACTGTGAGG - Intronic
990897582 5:60715697-60715719 GCGGCTTTGTTTACACTGTGAGG + Intergenic
990991525 5:61689123-61689145 GCTGCTTTGGTTGGACTGGGTGG + Intronic
991151483 5:63376169-63376191 GTGGCTTTGTTTACACCATGAGG - Intergenic
991161386 5:63507620-63507642 GCGACTTTGTTTACATTGTGAGG - Intergenic
991214258 5:64144048-64144070 GCTGCATTATTTACTCAGTGGGG - Intergenic
991223585 5:64243443-64243465 GCGTCTTTGTTTACATTATGAGG - Intronic
991283221 5:64939898-64939920 TCGGCTTTGTTTACACTGTGAGG + Intronic
991397739 5:66222635-66222657 GTGGCTTTGCTTACACTGTGAGG + Intergenic
991417214 5:66405308-66405330 TTGGTTTTGTTTACACTGTGAGG + Intergenic
991652084 5:68865626-68865648 GTGGTTTTGTTTACACTGTGAGG - Intergenic
991934773 5:71790458-71790480 GTGGCTTTGTTTACACTGTGAGG - Intergenic
992038865 5:72808811-72808833 GAGGCTTTGTTTACACTGTGAGG + Intergenic
992077877 5:73207428-73207450 GCGGGTTTGTTTACACTGTGAGG - Intergenic
992254867 5:74911548-74911570 GTGGCTTTGTTTACACTGTGAGG + Intergenic
992292424 5:75293025-75293047 GCGGCTTTCTTTACACTGTGAGG + Intergenic
992316959 5:75566147-75566169 CTGGGTTTGTTTACACTGTGAGG + Intronic
992369805 5:76131183-76131205 GCTGCTTGCTTTTCAGTGTGAGG + Intronic
992506065 5:77388853-77388875 GTGGCTTTGTTTACACTATGAGG + Intronic
992564493 5:77984651-77984673 TCTGGTTTGTTTACACTCTGCGG + Intergenic
992740604 5:79770084-79770106 GAGGCTTTGTTGACACCGTGAGG + Intronic
992907933 5:81365479-81365501 GTTGCTTTGTTTTTACTGTTAGG - Intronic
992908722 5:81373727-81373749 GTGGCTTTGTTTACACTGTAAGG - Intronic
992976891 5:82130125-82130147 GCGGCTTTCTTTACACTGTGAGG + Intronic
992977688 5:82138007-82138029 GAGGCTTTGTTTATACTGTGAGG + Intronic
993081095 5:83301990-83302012 ATGGCTTTGTTTACCCTGTGAGG + Intronic
993119140 5:83753820-83753842 GCAGCTTTGTTTACACTGTGAGG - Intergenic
993265495 5:85721681-85721703 GCAGCTTTGTTTATGCTGTGAGG - Intergenic
993381842 5:87217649-87217671 GCAGCTTTGTTTACACTGTGAGG + Intergenic
993455298 5:88120592-88120614 GTGGCTTTGTTTACACTATGAGG - Intergenic
993460150 5:88172909-88172931 GAGGCTTTGTTTACATTGTGAGG + Intergenic
993541643 5:89159538-89159560 GTGGCTTTGTTTACACTGTGAGG - Intergenic
993609024 5:90031868-90031890 GCGGATTTGTTTACACTGTGAGG - Intergenic
993673971 5:90795360-90795382 TTGGCTTTGTTTACACTGTGAGG - Intronic
993757611 5:91750994-91751016 GAGGCTTTGTTTACATCGTGAGG + Intergenic
993891700 5:93482810-93482832 GAGGCTTTGTTTACACTGTGAGG - Intergenic
993894999 5:93523207-93523229 GAGGCTTTGTTTACACTGTGAGG - Intergenic
993960949 5:94296187-94296209 GTGGCTTTGTTTACACTGTGAGG + Intronic
994005154 5:94828736-94828758 GCAGCTTTGTTTACACTGTGAGG + Intronic
994015056 5:94955625-94955647 GCAGCTTTGTTTATACTGTGAGG - Intronic
994137944 5:96309234-96309256 GCGGCTTTGTTTACAATGTGAGG + Intergenic
994142844 5:96361112-96361134 GCAGCTTTGTTTACACTCTTAGG + Intergenic
994160344 5:96549876-96549898 GCAGCTTTGTTTACATTGTGAGG - Intronic
994233522 5:97336171-97336193 GCAGCTTTGTTTATACTATGAGG + Intergenic
994286047 5:97969166-97969188 GCTGTTTTGTTCCCTCTGTGGGG - Intergenic
994378086 5:99037962-99037984 GATGCTTTGTTTACACTGTGAGG - Intergenic
994609534 5:102018924-102018946 GTGGCTTTGTTTACACTGTGAGG - Intergenic
994641970 5:102421480-102421502 TCGGCTTTGTTTACACTGTGAGG - Intronic
994991298 5:107000039-107000061 GTGCCTTTGATTACACTGTGAGG + Intergenic
995108214 5:108399136-108399158 TTGGTTTTGTTTACACTGTGAGG - Intergenic
995136559 5:108685881-108685903 GTGGCTTTGTTTACACTGTGAGG + Intergenic
995162487 5:108997916-108997938 GTGGCTTTGTTTACACTGTGAGG + Intronic
995263769 5:110135738-110135760 GTGGCTTTGTTTACACTGTGAGG + Intergenic
995280014 5:110323579-110323601 TATCCTCTGTTTACACTGTGGGG - Intronic
995326201 5:110892827-110892849 GTGGCTTTGTTTACACTGTGAGG + Intergenic
995398691 5:111716971-111716993 GCAGCTTTGTTTACACTGTGAGG + Intronic
995464428 5:112436325-112436347 GCAGCTTTGTTTACACTGTGAGG - Intergenic
995475056 5:112539312-112539334 GTGGCTTTGTTTACACTGTGAGG - Intergenic
995480384 5:112586695-112586717 TAGGCTTTGTTTACACTGTGAGG - Intergenic
995612376 5:113923963-113923985 GTGGCTTTGTTTACACTGTGAGG - Intergenic
995620621 5:114021608-114021630 GCGGCTTTTTTTACACTGTGAGG - Intergenic
995790643 5:115882982-115883004 GTGGGTTTGTTTACACTGTGAGG + Intronic
995808570 5:116080535-116080557 GCGGCTTTGTTTACAATGAGGGG - Intergenic
996129955 5:119769887-119769909 GCAGCTTTGTTTACACTGTGAGG - Intergenic
996910870 5:128655754-128655776 GCGGCTTTGTTTACACTGTAAGG + Intronic
996987480 5:129584679-129584701 GTAGCTTTGTTTACACTGTGAGG + Intronic
997216660 5:132117119-132117141 GTGGCTTTGTTTACACTGTGAGG - Intergenic
997220345 5:132157201-132157223 GCAGCTTTGTTTACACTGTGAGG + Intergenic
997252303 5:132398485-132398507 GGGGCTTTGTTTACACTGTGAGG - Intergenic
997809522 5:136953827-136953849 AAAGCTTTGTTTACACTGAGGGG + Intergenic
998691607 5:144594522-144594544 GCAGGTTTGTTTACACTGTGAGG + Intergenic
998768228 5:145512355-145512377 GTGGATTTGTTTACACTGTGAGG - Intronic
998934209 5:147216727-147216749 GCAGCCTTGTTTACACTGTGAGG - Intergenic
998972767 5:147610965-147610987 ATGGCTTTGTTTACACTGTGAGG + Intronic
999030056 5:148281065-148281087 GTGGCTTTGTTTACACTGTGAGG + Intronic
999468681 5:151831508-151831530 GCAGCTTTGTTTACACTGTGAGG - Intronic
999488708 5:152026789-152026811 GTGGCTTTGTTTACACTGTGAGG + Intergenic
999502366 5:152160089-152160111 GTGGCTTTGTTTACACTGTGAGG + Intergenic
999688328 5:154122514-154122536 GTGGCTTTGTTTACATTGTGTGG - Intronic
999983939 5:156984802-156984824 GCAGCTTTGTTTACACTGTGAGG - Intergenic
1000194756 5:158946968-158946990 GTGGCTTTGTTAACACTGTGAGG + Intronic
1000376107 5:160583810-160583832 GTGGCTTTGTTTACACTGTGAGG + Intronic
1000406495 5:160893405-160893427 GTGGCTTTGTTTACACTGGGAGG - Intergenic
1000417470 5:160998038-160998060 GAGGCTTTGTTTATACTTTGAGG + Intergenic
1000582204 5:163048422-163048444 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1000590050 5:163147089-163147111 GCAGCTTTGTTTACACTGTGAGG - Intergenic
1000798367 5:165693192-165693214 GTGGCTTTGTTTACCCTGTGAGG + Intergenic
1000958319 5:167569330-167569352 GCTACTTTGTTTACAGATTGTGG + Intronic
1000996089 5:167960477-167960499 GTGGCTTTGTTTACACTGTGAGG + Intronic
1001346371 5:170903265-170903287 GTGTCTTTGTTTACACTGTGAGG + Intronic
1001362659 5:171103382-171103404 GCAGCTTTGTTTACACTGTAAGG + Intronic
1002673542 5:180890056-180890078 GTGGCTTTGTTTACACTGAAGGG - Intergenic
1002677179 5:180926680-180926702 GTGGCTTTGTTTACACTGTGAGG - Intronic
1002734797 5:181377352-181377374 GTGGCTTTGTTTACACTGTGGGG + Intergenic
1002749733 6:96768-96790 GTGGCTTTGTTTACACAGTGGGG - Intergenic
1002944819 6:1750930-1750952 ATGGCTTTGTTTACACTGTGAGG - Intronic
1002996131 6:2286884-2286906 ATAGCTTTGTTTACACTGTGAGG - Intergenic
1003416880 6:5917627-5917649 GTGGCTTTGTTTACAATGTGAGG + Intergenic
1003713495 6:8619594-8619616 GCAGCTTTGTTTACACTGCAAGG + Intergenic
1004182855 6:13395906-13395928 TGTGCTTTGTTTACTCCGTGGGG + Intronic
1004944464 6:20596444-20596466 GCAGTTTTGTTTACACTGTGAGG + Intronic
1005208536 6:23432601-23432623 GCAGCTTTGTTTACACTGTGAGG + Intergenic
1005274200 6:24198867-24198889 GTGGCTTCGTTTACACTGTGAGG - Intronic
1007195592 6:40057062-40057084 ACAGCTTTGTTTACACCATGAGG + Intergenic
1007425070 6:41741222-41741244 GCTGCTCTGTTTACACGCAGAGG + Intronic
1007858148 6:44879284-44879306 GCAGCTTTGCTTACACTGTGAGG - Intronic
1008407581 6:51136224-51136246 GGGGCTTTGTTTACACTGTGAGG + Intergenic
1008575449 6:52856334-52856356 GTGGCTTTGTTTACACTGTGAGG + Intronic
1008785123 6:55158664-55158686 GTGGCTTTGTTTACACTGTGAGG - Intronic
1008865432 6:56204332-56204354 CTGGCTTTGTTTACACTGTGAGG - Intronic
1008896828 6:56565977-56565999 GGCAGTTTGTTTACACTGTGAGG + Intronic
1008997858 6:57679853-57679875 GCAGCTTTGTTTACACTGTGAGG - Intergenic
1009054345 6:58316833-58316855 GTAGCTTTGTTTACACTGTGAGG - Intergenic
1009186345 6:60579191-60579213 GCAGCTTTGTTTACACTGTGAGG - Intergenic
1009236791 6:61133746-61133768 GTAGCTTTGTTTACACTGTGAGG + Intergenic
1009264126 6:61532151-61532173 GTGGCTTTATTTATACTGTGAGG - Intergenic
1009305889 6:62089002-62089024 GCAGCTTTGTTTACACTGTGAGG + Intronic
1009455275 6:63849045-63849067 ATGGCTTTGTTTACACTGTGAGG - Intronic
1009458771 6:63887997-63888019 GAAGCTTTGTTTACACTGTGAGG - Intronic
1009492730 6:64312238-64312260 GTGGCTTTGTTTACACTGTGAGG - Intronic
1009536687 6:64896809-64896831 GCGGCTTTGTTCACACTGTGAGG - Intronic
1009652070 6:66489429-66489451 GCAGCTTTGTTTACACTGTGAGG - Intergenic
1009777096 6:68218736-68218758 GTGGTTTTGTTTATACTGTGAGG + Intergenic
1009795052 6:68456090-68456112 GAGGCTTTGTTTACACTGTGAGG + Intergenic
1009880524 6:69560828-69560850 GCAGCTTTGTTTACACTGTGAGG - Intergenic
1009945346 6:70336407-70336429 ATGGCTTTGTTTACTCTGTGAGG + Intergenic
1010039133 6:71361102-71361124 GAGGCTTTGTTTATACTGTGAGG + Intergenic
1010298011 6:74222976-74222998 GCCTCTTTGTTTACACTCTGAGG + Intergenic
1010459480 6:76097905-76097927 GTGGCTTTGTTTACACTGTAAGG - Intergenic
1010574958 6:77518874-77518896 GTGGCTTTGTTTACACTGTGAGG - Intergenic
1010615356 6:78005834-78005856 GCAGCTTTGTTTACACTGTGAGG - Intergenic
1010641063 6:78328243-78328265 GCTGCTTTGTTTACTGTCTGGGG - Intergenic
1010681791 6:78807420-78807442 GAGGCTTTGTTTACACTGTGAGG + Intergenic
1010822674 6:80433440-80433462 GGGGCTTTGTTTATACTGTAAGG + Intergenic
1010973122 6:82284137-82284159 GAGGCTTTGCTTACACTGTGAGG + Intergenic
1010994022 6:82512638-82512660 GTGGCTTTGTTTACACTGTGAGG - Intergenic
1011020680 6:82809274-82809296 GTACCTTTGTTAACACTGTGAGG + Intergenic
1011065509 6:83321509-83321531 GTGGCTTTATTTACACTGTGAGG - Intronic
1011086494 6:83546836-83546858 GCAGCTTTGTTTACACTATGAGG - Intergenic
1011302631 6:85892410-85892432 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1011318680 6:86065568-86065590 GAGGCTTTGTTTACATTATGAGG + Intergenic
1011333670 6:86236873-86236895 GTGGCTTTGTTTACACTTTGAGG - Intergenic
1011387669 6:86815414-86815436 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1011578205 6:88827750-88827772 GAGGCTTTGTTTACACTGGGAGG - Intronic
1011609896 6:89140656-89140678 GTTGTTTTGTACACACTGTGGGG + Intergenic
1011766274 6:90623466-90623488 GCAGCTTTGTTTATACTGTGAGG - Intergenic
1011776779 6:90739540-90739562 GTGGCTTTGTTTACACAGTGAGG + Intergenic
1011805626 6:91069870-91069892 TCTGCTTTGTTTACAAAGTGAGG + Intergenic
1012043425 6:94239041-94239063 TCAGTTTTGTTTACACTGTGAGG - Intergenic
1012083057 6:94785221-94785243 GTTGCTTTGTTTACACTGTGAGG + Intergenic
1012127924 6:95454030-95454052 GAGGCTTTGCATACACTGTGAGG + Intergenic
1012597103 6:101053932-101053954 GAAGCTTTGTTTACACTGTGAGG + Intergenic
1012644394 6:101661256-101661278 GCGGCTTTGTTTACACTGTGAGG + Intronic
1012778010 6:103522254-103522276 GCGGCTTTGTTTACACTGTGAGG - Intergenic
1012870900 6:104671437-104671459 GCGGCTTTGTTTACACTGTGAGG - Intergenic
1013038005 6:106405242-106405264 GCAGCTTTGTTTACACTGTGAGG - Intergenic
1013390253 6:109679314-109679336 AAGGCTTTGTTTACACTGTGAGG - Intronic
1013453005 6:110303523-110303545 GAGGCTTTGTTTACACTGTGAGG - Intronic
1013625654 6:111934748-111934770 GCGGCTTTATTTACACTGTGAGG + Intergenic
1013672635 6:112421736-112421758 GTGGCTTTCTTTACATTGTGAGG - Intergenic
1013682609 6:112541692-112541714 GCTGCTTTGTTTACTTTGTGAGG - Intergenic
1013920134 6:115394368-115394390 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1013939607 6:115645508-115645530 GCGGCTTTGTTTATGCTGTGAGG - Intergenic
1013956926 6:115852660-115852682 GAGGCTTTGTTTATATTGTGAGG - Intergenic
1013964224 6:115935706-115935728 GCAGCTTTGTTTAGACTGTGAGG - Exonic
1013972918 6:116042106-116042128 GTGGCTTTGTTTACACTGTGAGG - Intronic
1014113400 6:117645980-117646002 GCAGCTTTGTTTACACCGTGAGG - Intergenic
1014129083 6:117810779-117810801 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1014278853 6:119418301-119418323 GTGGCTTTGTTTACACTGTGAGG - Intergenic
1014352656 6:120363547-120363569 GCAGCTTTGTTTACACTGTGAGG + Intergenic
1014387056 6:120815976-120815998 TTAGCTTTGTTTATACTGTGAGG + Intergenic
1014466338 6:121760851-121760873 GCAGCTTTGTTCAGGCTGTGAGG - Intergenic
1014601285 6:123416518-123416540 GGTGCTGTGTTTTCACTGGGTGG - Intronic
1014836542 6:126166895-126166917 GAGGCTTTGTTTACAGTGTGAGG + Intergenic
1014872614 6:126614827-126614849 GAGGCTTTGTTTACACTGTGAGG + Intergenic
1014922441 6:127228846-127228868 GCGGCTTTGTTCACACTGTGAGG - Intergenic
1014968146 6:127782080-127782102 GTGGCTTTGTTTACATTGTTAGG + Intronic
1015108923 6:129569338-129569360 GCAGCTTTGTATACACTGTAAGG - Intergenic
1015211329 6:130701978-130702000 GTGGCTTTGTTTACACTGTGAGG - Intergenic
1015225199 6:130849759-130849781 TCTCCCTTGTTTAAACTGTGAGG - Intronic
1015291093 6:131538921-131538943 GTAGCTTTGTTTACACTGTGAGG - Intergenic
1015386986 6:132635484-132635506 GAGGCATTGTTTACACTGTGAGG - Intergenic
1015433204 6:133154846-133154868 GCAGCTTTGTTTACACTGTGAGG + Intergenic
1015471885 6:133614970-133614992 GTGGCTTGGTTTACACTGTGAGG - Intergenic
1015500776 6:133931045-133931067 GCAGTTTTGTTTACACTGTGAGG - Intergenic
1015623384 6:135156117-135156139 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1015802089 6:137070492-137070514 GCAGCTTTGTTTACACTGTGAGG - Intergenic
1015883269 6:137891173-137891195 GCGGCTTTGTTTACACTGTGAGG + Intergenic
1016483478 6:144508019-144508041 GAGGCTTTGTTTACACTGTGAGG + Intronic
1016638694 6:146324175-146324197 GCAGCTTTGTTTACACTGGGAGG + Intronic
1016651916 6:146471626-146471648 GATGTTTTGTCCACACTGTGAGG - Intergenic
1016856006 6:148671342-148671364 GCAGCTTTGTTTACATTGTGAGG + Intergenic
1017322640 6:153111299-153111321 GCGGCTTTGTTTAGACTGTGAGG - Intronic
1017571425 6:155748952-155748974 GTAGCTTTGTTTACACTGTGAGG - Intergenic
1018094507 6:160373789-160373811 GAGGCTTTGTTTACACGGTGAGG + Intronic
1018114619 6:160571656-160571678 GCGGTTTTGCTTACACTGTGAGG + Intronic
1018507819 6:164490742-164490764 GCGGCTTCATTTACACTGTGAGG + Intergenic
1019071890 6:169353636-169353658 GCAGCGTTGTTTACACCATGAGG + Intergenic
1019239055 6:170649672-170649694 GTGGCTTTGTTTACACAGTGGGG + Intergenic
1020333425 7:7042494-7042516 ACGGCTTTGTTTACAATGTGAGG - Intergenic
1020367224 7:7393734-7393756 GCAACTTTCTTTACATTGTGAGG + Intronic
1020391397 7:7662091-7662113 GCATCTTTGTTTACACTGTGAGG + Intronic
1020402733 7:7796746-7796768 GCTGATTTGGTTCCTCTGTGGGG - Intronic
1020487655 7:8738907-8738929 GCAGCTTTGTTTACACTGTGAGG + Intronic
1020519574 7:9169154-9169176 GTGGCTTCGTTTACACTGTGAGG + Intergenic
1020629753 7:10625726-10625748 GCAGCTTTCTTTACACCGTGAGG - Intergenic
1020639909 7:10742279-10742301 GAGGCTTTTTTTACACTGTGAGG - Intergenic
1020694051 7:11392741-11392763 GCAGCTTTGTTTACACTGTGAGG - Intronic
1020753405 7:12170639-12170661 GAAGCTTTGTTTACACTGTGAGG + Intergenic
1020823834 7:13002745-13002767 GTGGCTTTGTTTACAAGGTGAGG + Intergenic
1020874256 7:13673801-13673823 GCAGCTTTGTTTACACTGTGAGG + Intergenic
1020899572 7:13988875-13988897 TCTGCTTTGTTGCCACTGTAGGG - Intronic
1020935507 7:14459061-14459083 GTGGCTTTGTTTACACTGTGAGG - Intronic
1021099538 7:16572054-16572076 GCGGCTTTGTTAACACTGTGAGG - Intronic
1021207882 7:17807334-17807356 GAGGCTTTGTTTACACTATAAGG - Intronic
1021322327 7:19227260-19227282 GTAGCTTTGATTACACTGTGAGG - Intergenic
1021347660 7:19548019-19548041 GTGGCTTTGTTTACAATGTGAGG + Intergenic
1021483960 7:21146901-21146923 GAGGCTTTGTTTACACTGGGAGG - Intergenic
1021502311 7:21345087-21345109 GCTGCTTTATTTACACTGTGAGG + Intergenic
1021749335 7:23779618-23779640 GTGGCTTTGTTTACACTGTGAGG + Intronic
1021782296 7:24118091-24118113 GTGGCTTTGTTTGCACTGTGAGG + Intergenic
1022058838 7:26770236-26770258 GTGGCTTTGTTTACACTATGAGG + Intronic
1022344360 7:29499851-29499873 GCTTCTTTGTTTACAGACTGTGG + Exonic
1022805313 7:33815391-33815413 CCTGCTCTGTTTTCACTTTGTGG + Intergenic
1022848449 7:34235417-34235439 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1022869133 7:34457573-34457595 GCGGCTTTGTTTACACTGTGAGG - Intergenic
1023051740 7:36258608-36258630 GCGGCTTTGTTTACATTGTGAGG + Intronic
1023511612 7:40959449-40959471 CCAGCTTTGTTTACACTGTGAGG + Intergenic
1023697755 7:42865212-42865234 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1024372904 7:48606986-48607008 AGGGCTTTGTTTACACTTTGAGG + Intronic
1024495458 7:50041016-50041038 GCAGCTTTATTTACACTGTGAGG - Intronic
1024664892 7:51536545-51536567 GCAGCTTTGTTTACACTGTGAGG + Intergenic
1024950502 7:54855808-54855830 GTGGCTTTGTTTACACTATGAGG + Intergenic
1024998512 7:55294695-55294717 GTGGCTTTGTTTACACTATGAGG + Intergenic
1025621378 7:63174779-63174801 GTAGCTTTGTTTACACTGTGAGG + Intergenic
1026149899 7:67779080-67779102 GTTGGTTTGTTTACAGTTTGGGG - Intergenic
1026488150 7:70838532-70838554 AGGGCTTTGTTTACACTGTGAGG - Intergenic
1026546619 7:71328666-71328688 GCTGCTTTGTTGAACCTTTGTGG + Intronic
1026607017 7:71825063-71825085 GCTGCATTGTTTGCGCTGTGGGG - Intronic
1027446058 7:78274721-78274743 GCAGCTTTATGTACACTGTGAGG + Intronic
1027510348 7:79071743-79071765 GTGGCTTTGTTTACACTGTGAGG + Intronic
1027582897 7:80020481-80020503 GAGGCTTTGTTTACACTGTGAGG - Intergenic
1027637094 7:80689401-80689423 GCATCTTTGTTTATACTGTAAGG - Intergenic
1027778208 7:82492505-82492527 GTGGCTTTGTTTACACTGAGAGG + Intergenic
1027790406 7:82633746-82633768 GTGGCTTTGTTTACACTGAGAGG - Intergenic
1027843367 7:83341983-83342005 GAAGCTTTGTTTACACTGTGAGG - Intergenic
1028142358 7:87288190-87288212 GTGGCTTTGTTTACACTGTCTGG + Intergenic
1028144309 7:87304715-87304737 GCAGCTTTTTTTACACTGTGAGG - Intergenic
1028145868 7:87319297-87319319 GCGGCTTTGTTTACACTGTGAGG + Intergenic
1028429947 7:90735607-90735629 ATGGCTTTGTTTACACTGTGAGG + Intronic
1028627949 7:92898497-92898519 GCAGCTTTGTCTACACTGTGTGG + Intergenic
1028630257 7:92926464-92926486 GGGGCTTTGTTTACACTGTGAGG + Intergenic
1028648273 7:93121689-93121711 GTGGCTTTGTTTACACTGTGAGG - Intergenic
1028652833 7:93170192-93170214 GCAGCTTTGTGTACCCTGTGAGG + Intergenic
1028801388 7:94969928-94969950 GTGGCTTTGTTTACACTGTGAGG + Intronic
1028806028 7:95026865-95026887 TCTGCTTTGTTTACACTGTGAGG + Intronic
1028991268 7:97051268-97051290 GCGGCTTTGTTTCCACTGTGAGG - Intergenic
1029816992 7:103106609-103106631 GTGGCTTTGTTTACACTGTGAGG - Intronic
1029845241 7:103405960-103405982 GTGGCTTTGTTTACACTGTGAGG + Intronic
1029851095 7:103462527-103462549 TTGGCTTTGTTTACACTGTGAGG + Intergenic
1030141025 7:106304268-106304290 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1030159551 7:106493231-106493253 GTGGCTTTGTTTACACTGTGAGG - Intergenic
1030534042 7:110744117-110744139 GTGGCTTTGTTTACACTGTGAGG - Intronic
1030703065 7:112662343-112662365 GCGTCTTTGTTTACACTGTGAGG + Intergenic
1030705623 7:112689947-112689969 GCGGCTTTGTTTACACTGTGAGG + Intergenic
1030801352 7:113856628-113856650 GAGGCTTTGTTTACACTGTAAGG - Intergenic
1030958863 7:115889507-115889529 GAGGCTTTGTTTACACTGTGAGG - Intergenic
1031167962 7:118253326-118253348 GCTCCTTTGTCTTCACTTTGGGG + Intergenic
1031397727 7:121293287-121293309 GCGGTTTTGTTTACACTGTGAGG + Intronic
1031613757 7:123856967-123856989 GTGGCTTTGTTTACACTTTGAGG + Intronic
1031711015 7:125046660-125046682 GCAGCTTTGTTTACACTGTGAGG - Intergenic
1031902707 7:127428543-127428565 GAGGCTCTGTTTACACTGTGAGG + Intronic
1032312571 7:130802307-130802329 GTGGCTTTGTTTACACTTTGAGG + Intergenic
1032604047 7:133330203-133330225 GTGGCATTGTTTACTCTGTGAGG + Intronic
1032659739 7:133970126-133970148 GTGGCTTTGTTTACACTGTGAGG + Intronic
1032883453 7:136114611-136114633 GTAGCTTTATTTACACTGTGAGG + Intergenic
1032893331 7:136222839-136222861 GTGGCTTTGTTTACACTGTGAGG - Intergenic
1032957102 7:136984221-136984243 GAGGCTTTGTTTGCACTGTGAGG + Intronic
1032966460 7:137103747-137103769 GCGGCTTTGTTTACACTGTGAGG - Intergenic
1033525625 7:142210547-142210569 GTGGCTTTGTTTACACTGTGAGG - Intronic
1034097691 7:148425067-148425089 GTGACTTTTTTTACACTGTGAGG - Intergenic
1034314499 7:150117441-150117463 GTGGCTTTGTTTACACTGTGAGG - Intergenic
1034715100 7:153234773-153234795 GCGGCTTTGTTTACACTGTGAGG + Intergenic
1034792397 7:153983328-153983350 GTGGCTTTGTTTACACTGTGAGG + Intronic
1035508715 8:156937-156959 GTGGCTTTGTTTACACAGTGGGG - Intergenic
1035710764 8:1712238-1712260 GAGGCTTTGTTTACACGGTGAGG - Intergenic
1035998303 8:4573904-4573926 GCAGCTATGTTTACACTGTGAGG + Intronic
1036553794 8:9839031-9839053 GTGGCTTTGTTTACACTGTGAGG - Intergenic
1036558019 8:9876947-9876969 GCAGCTTTGTTTACACTGTGAGG - Intergenic
1037258273 8:16979599-16979621 GAGGCTTTGTTTACACTGTAAGG + Intergenic
1037285461 8:17294234-17294256 GAGGCTTTGTTTACACTGTGAGG + Intronic
1037664540 8:20956648-20956670 GTGGCTTTGTTTACACTGGGGGG - Intergenic
1037719663 8:21431712-21431734 GGAGCTTTGTTTACACTGTGAGG - Intergenic
1038211590 8:25523400-25523422 GCAGCTTTGTTTAAACTGTGAGG - Intergenic
1038281323 8:26167933-26167955 GGTGCTTTGCTTGTACTGTGGGG + Intergenic
1038921628 8:32091331-32091353 GTTGCTTTGTTAGCACTGAGAGG - Intronic
1038936436 8:32257066-32257088 GGTGCTTTATTTACACTGTGAGG + Intronic
1039133860 8:34297929-34297951 GTAGCTTTGTTTACACTGTGAGG - Intergenic
1039284572 8:36026728-36026750 GCGACTTTGTTTACACTGTGAGG - Intergenic
1039368638 8:36960951-36960973 GCTGCTTTGGATAAACAGTGTGG - Intergenic
1039754824 8:40512220-40512242 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1040355020 8:46608790-46608812 GCAGCTTTGTTTACACTCTGAGG - Intergenic
1040473850 8:47759907-47759929 GTGTCTTTGTTTACACTGTGAGG + Intergenic
1040520080 8:48169149-48169171 GTGGCTTTGTTTATACTGTGAGG + Intergenic
1040736567 8:50515661-50515683 GCAACTTTGTTTACACTGTGAGG - Intronic
1040779915 8:51095329-51095351 GCAGCTTTGTTTACACTGTGAGG - Intergenic
1040943031 8:52852441-52852463 TTGGCTTTGTTTACACTGTGAGG + Intergenic
1040968794 8:53112265-53112287 GCGGCTTTGTTTACACTGTGAGG + Intergenic
1041155072 8:54977246-54977268 CCAGTTTTGTTTACACTGTGAGG - Intergenic
1041323295 8:56637098-56637120 GCAGCTTTGTTTACACTGTGTGG + Intergenic
1041383162 8:57273234-57273256 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1041423570 8:57695531-57695553 GCAGCTTTGTTTACACTGTGAGG - Intergenic
1041459731 8:58098325-58098347 GCAGCTTTGTTTATGCTGTGAGG + Intronic
1041630558 8:60082716-60082738 GAGGCTTTGTTTACACTGTGAGG + Intergenic
1041666327 8:60448426-60448448 GAGGCTTTGTTTACACTGTGAGG - Intergenic
1041836650 8:62223781-62223803 GGGGCTTTGTTTACACTGTGAGG - Intergenic
1041838322 8:62242017-62242039 GGGGCTTTGTTTACACTGTGAGG + Intergenic
1041900619 8:62978497-62978519 GCAGCTTTGTTTACACTGTGAGG + Exonic
1041944333 8:63424559-63424581 CCGGCTTTGTTTACACTGGAAGG - Intergenic
1042070796 8:64931192-64931214 GCAGCTTTGTTTACACTGTGAGG + Intergenic
1042110942 8:65380303-65380325 GTGGCTTTGTTTATGCTGTGAGG - Intergenic
1042349362 8:67761478-67761500 GAGGCTTTGTTTACACTGTGAGG - Intergenic
1042478820 8:69280553-69280575 ATGGCTTTGTTTACACTGTGTGG - Intergenic
1042627148 8:70770695-70770717 GTGGCTTTGTTTACACTGTGAGG + Intronic
1042812897 8:72845720-72845742 GCAGCTTTGATTACACCGTGAGG + Intronic
1042946193 8:74156863-74156885 GCAGCTTTGTTTACACTGTGAGG - Intergenic
1042969296 8:74390964-74390986 GTGGCTTTGTTTACACTATGAGG + Intronic
1043368257 8:79560434-79560456 AGGGCTTTGTTTACACTATGAGG + Intergenic
1043647234 8:82536148-82536170 GCAGCTTTGTTTACACTGTGAGG + Intergenic
1043703627 8:83322144-83322166 GTGGCTTTGTTTACATTGTGAGG - Intergenic
1044131111 8:88525546-88525568 TAGGCTTTGCTTACACTGTGAGG - Intergenic
1044503574 8:92991111-92991133 GTGGCTTTGTTTACACTGGGAGG - Intronic
1044509458 8:93058245-93058267 GCAGCTTTGTTTACACTGTGAGG + Intergenic
1044595243 8:93953051-93953073 GCAGCTTTGTTTACATAGTGAGG + Intergenic
1044940240 8:97334921-97334943 GTGGCTTTGTTTACACTGTAAGG + Intergenic
1044961030 8:97530535-97530557 GAGGCTTTATTTACACTGTGAGG - Intergenic
1045151770 8:99416197-99416219 ATGGCTTTGTTTACACTGTGTGG + Intronic
1045185166 8:99830381-99830403 GAGGCTTTGTTTACACTGTGAGG + Intronic
1045390595 8:101710624-101710646 GTGGCTTTGTTTACACTGTGAGG - Intronic
1045506570 8:102782760-102782782 GCTGGCTTGTCTACACTGGGTGG - Intergenic
1045618910 8:103951961-103951983 GCCGCTTTGTTTACACTGTGAGG - Intronic
1045783696 8:105897330-105897352 GTGGCTTTGTTTACACTGTGAGG - Intergenic
1045839360 8:106561334-106561356 GTGGCTTTGTTTATACTGTGAGG - Intronic
1045894733 8:107201733-107201755 ATTGGTTTGTTTATACTGTGAGG + Intergenic
1045973349 8:108104142-108104164 GCGGCTTTGTTTACACTGTGAGG - Intergenic
1045975081 8:108122807-108122829 GCAGCTTTGTTTACACTATGAGG + Intergenic
1046047963 8:108986344-108986366 GCGGCTTTGTTTACACTGAGGGG + Intergenic
1046067967 8:109218791-109218813 GCGGCTTTGTTTACACTATGAGG + Intergenic
1046106510 8:109672890-109672912 GTGGCTTTGTTTACACTGTGTGG - Intronic
1046153466 8:110257662-110257684 GCAGTTTTGTTTACACTGAGGGG + Intergenic
1046219942 8:111201019-111201041 GTGGCTTTGTTTACACTGTGAGG - Intergenic
1046277825 8:111985936-111985958 GAGGCTTTGCTTATACTGTGAGG - Intergenic
1046295877 8:112218484-112218506 GCAGCTTTGTTTACACTGTGAGG - Intergenic
1046947459 8:119987799-119987821 GTGGCCTTGTTTACACTGTGAGG + Intronic
1046972528 8:120238389-120238411 GCAGCTTTGTTTACACTGTGAGG + Intronic
1047133690 8:122051722-122051744 GCAGTTTTATTTACACTGTGAGG - Intergenic
1047369568 8:124245332-124245354 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1048467067 8:134674457-134674479 GCAGCTTTTGTTACACTGTGAGG - Intronic
1048676169 8:136783633-136783655 GCTGCTTTTTGTACAGTGTGTGG + Intergenic
1048914104 8:139165455-139165477 CCTGCTTTGTTTACACTGTGAGG + Intergenic
1049026874 8:139997626-139997648 GATGCATTGTTTCCCCTGTGTGG - Intronic
1049026889 8:139997716-139997738 GATGCATTGTTTCCCCTGTGTGG - Intronic
1050141540 9:2521286-2521308 GTAGCTTTATTTACACCGTGAGG + Intergenic
1050201331 9:3148790-3148812 GTGGCTTTGTTTAGACCGTGAGG + Intergenic
1050239887 9:3624117-3624139 GTGGTTTTGTTTACACTATGAGG + Intergenic
1050300495 9:4253389-4253411 GTGGCTTTGTTTACACTATGAGG + Intronic
1050369018 9:4901866-4901888 GCAGCTTTGTTTACACTGTGAGG + Intergenic
1050391961 9:5153399-5153421 GTGGCTTTGTTTACACCGTGAGG - Intronic
1050450856 9:5779853-5779875 GTGGCTTTGTTTACACTGTGAGG - Intronic
1050637421 9:7626863-7626885 GCAGCTTTTTTTACACTGTGAGG - Intergenic
1050700174 9:8329791-8329813 CTGGCTTTGTTTACACTGTGAGG + Intronic
1050750603 9:8932653-8932675 GCGGCTTTGTTTACACTGTGAGG + Intronic
1050852072 9:10300623-10300645 GTGGCTTTGTTTACACTGTGAGG - Intronic
1050943141 9:11485533-11485555 GTGGCTTTCTTCACACTGTGAGG + Intergenic
1050973904 9:11912192-11912214 GTGGCTGTGTTTACACTGTGAGG + Intergenic
1051230477 9:14950089-14950111 ACGGCTTTGTTTACACTGTGAGG - Intergenic
1051321932 9:15914428-15914450 GAGGCTTTGTTTAAACTGTGAGG + Intronic
1051548741 9:18305565-18305587 GCGGCTTTGTTTACACTGTGAGG - Intergenic
1051611636 9:18967526-18967548 CTGGCTTTGTTTACACTGTAAGG + Intronic
1051670459 9:19504854-19504876 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1051674567 9:19546468-19546490 GTGGCTTTGTTTACACTGTCAGG + Intronic
1051695801 9:19767075-19767097 GTGACTTTGTTTCCACTGTGAGG + Intronic
1051814334 9:21087581-21087603 GCAGCTTTTTTTACACCGTGAGG - Intergenic
1051940210 9:22496231-22496253 GCAGCTTTGTTTACACTGTGAGG + Intergenic
1052052705 9:23866385-23866407 GTGACTTTGTTTACGCTGTGAGG + Intergenic
1052061533 9:23966433-23966455 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1052096572 9:24391261-24391283 GTGGCTTTGTTTACACCCTGAGG + Intergenic
1052125121 9:24765180-24765202 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1052134097 9:24889137-24889159 GTGGCTTTGTTTACACTGTGAGG - Intergenic
1052241388 9:26277762-26277784 GTGGCTTTGTTTACACTGTCAGG - Intergenic
1052336375 9:27324394-27324416 GCTGCTTTGTTTATACTGTGAGG + Intergenic
1052366181 9:27614715-27614737 GCAGCTTTGTTTACACCGTGAGG + Intergenic
1052746656 9:32448305-32448327 AAGACTTTGTTTACACTGTGAGG + Intronic
1052752757 9:32508959-32508981 GTGGCTTTGTTTACACTGTGAGG - Intronic
1053608151 9:39681170-39681192 GCAGCTTTGTTTACACTGTGAGG + Intergenic
1053865992 9:42437530-42437552 GCAGCTTTGTTTACACTGTGAGG + Intergenic
1054245380 9:62661239-62661261 GCAGCTTTGTTTACACTGTGAGG - Intergenic
1054559509 9:66695770-66695792 GCAGCTTTGTTTACACTGTGAGG - Intergenic
1054719867 9:68593928-68593950 GCAGCTTTGTTTACACTGTGAGG + Intergenic
1054985979 9:71262297-71262319 GGGGCTTTGTTTACACTGTGAGG + Intronic
1055061439 9:72072857-72072879 GCAGCTTTGTTTACACTGTGAGG - Intergenic
1055125700 9:72716544-72716566 GCAACTTTGTGTACACTGTGAGG + Intronic
1055210329 9:73783407-73783429 GTGGCTTTGTTTACACTGTGAGG - Intergenic
1055239237 9:74163854-74163876 GTGGCTTTGTTTACACAGTGTGG - Intergenic
1055386826 9:75771723-75771745 GTGGCTTTGTTTACACTATGAGG + Intergenic
1055390933 9:75821525-75821547 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1055494585 9:76841656-76841678 GCAGCTTTGTTTACACTATGAGG - Intronic
1055537866 9:77267948-77267970 GCAACTTTGTTTACACTGTGAGG + Intronic
1055571791 9:77624128-77624150 GCTGCTTTGTTTACACTGTGAGG - Intronic
1055628768 9:78201307-78201329 TAGGCTTTGTTTACACTGTGAGG - Intergenic
1056000992 9:82216251-82216273 GCAGCTTTGTTTTCACTGTGAGG - Intergenic
1056003514 9:82242782-82242804 GTGGCTTTCTTTACACTGTGAGG + Intergenic
1056123750 9:83514321-83514343 GCAGCTTTGTTTACACTGTGAGG - Intronic
1056176771 9:84043846-84043868 GTGGCTTTGTTTATACTGTGAGG + Intergenic
1056302619 9:85257930-85257952 GCAGCTTTGTTCACACTGTGAGG + Intergenic
1056320930 9:85433775-85433797 GTGGCTTTGTTTACACTGTAAGG - Intergenic
1056997764 9:91479427-91479449 GTGACTTTGTTTACACTGTGAGG + Intergenic
1057460335 9:95254936-95254958 GCGGCTTTGTTTACGCTGTCAGG - Intronic
1058029287 9:100177484-100177506 GTGGCTTTGTTTACACTGTGAGG - Intronic
1058034568 9:100237140-100237162 GAGGCTTTGTTTACACTGTGAGG + Intronic
1058072859 9:100619394-100619416 GTGGCTTTCTTTACACCGTGAGG + Intergenic
1058093267 9:100829541-100829563 GCGGCTTTGTTTACACTGTGAGG + Intergenic
1058182531 9:101815875-101815897 GTGGCTTTGTTTACACTGTGAGG - Intergenic
1058393201 9:104520532-104520554 GCAGCTTTCTTTACACTATGAGG - Intergenic
1058492363 9:105516054-105516076 GCAGCTTTGTTTACACTATGAGG - Intronic
1059088865 9:111334652-111334674 GCGGCTTTGTTTACACTGTGAGG - Intergenic
1059513366 9:114870068-114870090 GAGGCTTTGTTTACACTGTGAGG - Intergenic
1061951808 9:133940450-133940472 GCTGCTTGGTTTACGCTCTTAGG - Intronic
1062297620 9:135841208-135841230 GCGGCTTTGTTTACACTGTGAGG - Intronic
1062759260 9:138329962-138329984 GTGGCTTTGTTTACACAGTGGGG + Intergenic
1203526793 Un_GL000213v1:97948-97970 GCTGCTCTGTTTTCTCTGTGTGG + Intergenic
1203599710 Un_KI270748v1:735-757 GTGGCTTTGTTTACACAGTGGGG + Intergenic
1186181305 X:6975981-6976003 GCAGCTTTGTTTACGCTGTGAGG + Intergenic
1186354217 X:8773313-8773335 GCAGCTTTGTTTACCCTGTGAGG - Intergenic
1186370003 X:8937173-8937195 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1186599790 X:11024575-11024597 GTGGCTTTGTTTACACTGTGTGG + Intergenic
1186773300 X:12839139-12839161 GCAGCTTTGTTTACACTGTGAGG + Intergenic
1186960936 X:14736016-14736038 GTGACTTTGTTTACACTGTGAGG + Intergenic
1187660866 X:21545245-21545267 GAGGCTTTGTTTACACTGTGAGG - Intronic
1187729050 X:22234547-22234569 GTGGCTTTGTTTACACTGTGAGG + Intronic
1187729547 X:22238626-22238648 GTGGCTTTGTTTACACTGTGAGG - Intronic
1187784331 X:22867039-22867061 GTGGCTTTGTTTACACTGTGAGG - Intergenic
1187839930 X:23476673-23476695 GCGGCTTTGTTTACAATCTGAGG + Intergenic
1188084145 X:25882731-25882753 GATGCCTTGTTTACACTGTGAGG - Intergenic
1188130006 X:26419546-26419568 GCGGCTTTGTTTACACTGTGAGG + Intergenic
1188201701 X:27299880-27299902 GTGACTTTGTTTACAGTGTGAGG - Intergenic
1188436299 X:30162762-30162784 GGTGCTTTTCTTTCACTGTGTGG + Intergenic
1188561229 X:31470931-31470953 ACGGCTTTGTTTACACTGTGAGG + Intronic
1188664650 X:32804332-32804354 GCGACTTTGTTTACACTGTGAGG - Intronic
1188893280 X:35636144-35636166 GTGGCTTTGTTCACACTTTGAGG + Intergenic
1188921909 X:35987391-35987413 GAGGCTTATTTTACACTGTGAGG + Intronic
1189189650 X:39089164-39089186 GCGGCTTTGTTTACACTGTGAGG - Intergenic
1189210800 X:39280486-39280508 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1189243363 X:39542522-39542544 GTAGCTTTGTTTACACTGTGAGG - Intergenic
1189575092 X:42343152-42343174 GTGGTTTTGTTTACACTGTGAGG + Intergenic
1189590657 X:42507389-42507411 GTGGCTTTGTTTACACTGTGAGG - Intergenic
1189754151 X:44253481-44253503 GCAGCTTTGTTTACACTGTGAGG - Intronic
1189937779 X:46087479-46087501 GCAGCTTTGTTTACACTGTGAGG - Intergenic
1190495070 X:51020844-51020866 GTGGCTTTGTTTACACCATGAGG + Intergenic
1190505893 X:51125583-51125605 GTGGCTTTGTTTACACTGTGAGG - Intergenic
1191005091 X:55702782-55702804 GCAGCTTTGTTTACACTGTGAGG - Intergenic
1191024286 X:55896752-55896774 GTGGCTTTGTTTATGCTGTGAGG - Intergenic
1191072013 X:56410807-56410829 GCAGCTTTGTTTACACTGGGAGG + Intergenic
1191088704 X:56597447-56597469 GCAGCTTTGTTTATACTGTGAGG + Intergenic
1191098959 X:56704713-56704735 GCAGCTTTGTTTACACTGTGAGG + Intergenic
1191112006 X:56811537-56811559 GCAGCTTTGTTTACACTGTAAGG + Intergenic
1191113924 X:56832366-56832388 GCAGCTTTGTTTACACTGTGAGG + Intergenic
1191119752 X:56890981-56891003 GCATCTTTGTTTACACTGTGAGG - Intergenic
1191133279 X:57037815-57037837 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1191135393 X:57058704-57058726 GCACCATTGTTTACACTGTGAGG + Intergenic
1191168521 X:57418012-57418034 AAGGCTTTGTTTACACTGAGGGG + Intronic
1191606263 X:63066002-63066024 GTGGCTTTGTTTACACTGTGAGG - Intergenic
1191631962 X:63331386-63331408 GAGGCTTTGTTTACAGTGAGAGG - Intergenic
1191657456 X:63613827-63613849 GTGGCGTTGTTTACACTGTGGGG - Intergenic
1191676643 X:63798135-63798157 GTGGCTTTGTTTATGCTGTGAGG - Intergenic
1191686751 X:63899806-63899828 GCATCTTTGTTTACACTGTGAGG - Intergenic
1191705133 X:64086046-64086068 GCAGCTTTGTTTACACTGTGAGG - Intergenic
1191788754 X:64945861-64945883 GTGGCTTTGTTTACACTGTGTGG + Intronic
1191793789 X:64999799-64999821 GAGGATTTATTTACACTGTGAGG - Intronic
1191795668 X:65018893-65018915 GCAGCTTTGTTTATACTCTGAGG - Intronic
1191799912 X:65066921-65066943 GTGGCTCTGTTTACACTGTGAGG + Intergenic
1191810018 X:65176248-65176270 GTGGCTTTCTTTACACTGTGAGG - Intergenic
1191824858 X:65353822-65353844 GTGACTTTGTTTACACTGTGAGG - Intergenic
1191848587 X:65569102-65569124 GGGGCTTTGTTTACACTGTGAGG + Intergenic
1191872928 X:65765161-65765183 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1191931346 X:66376425-66376447 GTTGCTTTGTTTACACTGTGAGG + Intergenic
1191947766 X:66554151-66554173 GCAGCTGTGTTTACACTGTAAGG - Intergenic
1191969683 X:66799390-66799412 GCGACTTTGTTTACAGTGTGAGG - Intergenic
1191987209 X:66994856-66994878 GCAACTTCCTTTACACTGTGTGG + Intergenic
1192009268 X:67250556-67250578 GTAGCTCTGTTTACACTGTGAGG - Intergenic
1192020601 X:67386745-67386767 ACAGCTTAGTTTACACTGTGAGG - Intergenic
1192064265 X:67864519-67864541 GAGGCTTTGTTTACACTGTGAGG + Intergenic
1192128964 X:68530247-68530269 GTGGCTTTCTTTACACTGTGAGG + Intronic
1192228475 X:69246267-69246289 GTGGCTTTGTTTGCACTATGAGG - Intergenic
1192524560 X:71830324-71830346 GGGGCTTTATTTACACTGTTAGG - Intergenic
1192551093 X:72054169-72054191 ACTCCTCTGTCTACACTGTGTGG + Intergenic
1192637173 X:72830900-72830922 GAGGCTTTGTTTACACAGTGAGG + Intronic
1192644541 X:72889914-72889936 GAGGCTTTGTTTACACAGTGAGG - Intronic
1192662148 X:73052731-73052753 GTGGTTTTGTTTACACTGTGAGG - Intergenic
1192712598 X:73607263-73607285 GCAGGTTTGTTTACGCTGTGAGG + Intronic
1192741039 X:73892890-73892912 GTGGCTTTGTTTACACCGTGAGG - Intergenic
1192884258 X:75320334-75320356 GCAGCTTCGTTTACACTGTGAGG + Intergenic
1192922737 X:75724379-75724401 GGGGCTTTGCTTACACTGTGAGG + Intergenic
1192938005 X:75881430-75881452 GAAGCTTTGTTTATACTGTGAGG + Intergenic
1192958161 X:76095627-76095649 GCAGCTTTGTTTACACTGTGAGG + Intergenic
1192964181 X:76159670-76159692 GCGGCTTTGTTTACACTGTGAGG - Intergenic
1192966534 X:76183061-76183083 GAGGCTTTGTTTACACTGTGAGG + Intergenic
1192974963 X:76273472-76273494 GTGGCTTCATTTACACTGTGAGG + Intergenic
1192977651 X:76303202-76303224 GTAGCTTTGTATACACTGTGAGG + Intergenic
1192984298 X:76380064-76380086 GAGGGTTTGTTTACACCGTGAGG - Intergenic
1192992136 X:76471594-76471616 GTAGCTTTGTTTACACTTTGAGG - Intergenic
1192999609 X:76550226-76550248 GCAGCTTTGTTTACACTGTGAGG + Intergenic
1193003637 X:76591204-76591226 CCAGTTTTGTTTACATTGTGAGG + Intergenic
1193010652 X:76671392-76671414 GTGGCTTTGTTTATATTGTGAGG - Intergenic
1193034490 X:76934585-76934607 GTGGCTTTGTGTACACTGTGAGG - Intergenic
1193068603 X:77283187-77283209 GCAGCTTTCTTTACACCGTAAGG - Intergenic
1193075201 X:77347844-77347866 GTGTCTTTGTTTACACTGTGAGG - Intergenic
1193079358 X:77390563-77390585 GGGGCTTTGTTTACACTGCGAGG - Intergenic
1193081573 X:77411821-77411843 GCAGCTTTGTTTACACTGTGAGG + Intergenic
1193266860 X:79482372-79482394 GGGGCTTTGTTTACACTGTAAGG - Intergenic
1193284612 X:79697066-79697088 GCATCTTTGTTTACACAGTGTGG + Intergenic
1193350855 X:80462841-80462863 GCAGCTTTGTTTATGCTGTGAGG - Intergenic
1193352029 X:80474935-80474957 GCAGCTTTGTTTACACTGTGAGG + Intergenic
1193355976 X:80520977-80520999 GCCGCTTTGTTTACATTGTGAGG + Intergenic
1193389183 X:80906463-80906485 CCAGCTTTGTTTACACTGCGAGG - Intergenic
1193409340 X:81143857-81143879 GTGGCTTTGTTTACATGGTGAGG - Intronic
1193525276 X:82581116-82581138 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1193562676 X:83038149-83038171 GCGGCTTTGTTTATTCTGTGTGG - Intergenic
1193646785 X:84079684-84079706 GTGGCTTTGTTTACGCTGTCAGG - Intronic
1193685444 X:84571840-84571862 GCGGCTTTGTTTACACTGTGAGG - Intergenic
1193830018 X:86278901-86278923 GAGGCTTTGTTTACACTGTGAGG - Intronic
1193878744 X:86896212-86896234 GTGGCTTTGTTTAAACTGTGAGG - Intergenic
1193897285 X:87128964-87128986 GTGCCTTTGTTTACACTATGAGG - Intergenic
1193906737 X:87253701-87253723 GAAGCTTTATTTACACTGTGAGG + Intergenic
1193949344 X:87778771-87778793 TTGGCTTTGTTTACACTGTGAGG - Intergenic
1194158555 X:90422782-90422804 GCAGCTTTGTTTACACTGTGAGG - Intergenic
1194203531 X:90983667-90983689 GTGGCTTTGGTTACATTGTGAGG - Intergenic
1194203567 X:90983889-90983911 GAGGCTTTGTTTACACTGTGAGG - Intergenic
1194208490 X:91039954-91039976 GCAGCTTTGTTTACACTGTGAGG + Intergenic
1194355795 X:92882331-92882353 GTGGCTTTGTTTACACTGTGAGG - Intergenic
1194391178 X:93319793-93319815 GTGGCTTTGTTAACACTGTGAGG - Intergenic
1194419941 X:93661067-93661089 GTGGCTTTGTTTACCCTGTGGGG - Intergenic
1194515318 X:94844973-94844995 GCAGCTTTGTTTACACTGTGAGG + Intergenic
1194559561 X:95403758-95403780 GTAGCTTTGTTTACACTGTGAGG - Intergenic
1194576340 X:95618701-95618723 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1194652627 X:96533624-96533646 GTGGCTTTGTTTACACTGTGAGG - Intergenic
1194771815 X:97915618-97915640 GCGGCTCTGTTTACACTACGAGG - Intergenic
1194783118 X:98049138-98049160 GTAGCTTTGTTCACACTGTGAGG + Intergenic
1194798380 X:98240620-98240642 GCGGCTTTGTTTACACTGTGAGG + Intergenic
1194959056 X:100214554-100214576 ATGGCTTTGTTTACACTGTGAGG + Intergenic
1194961027 X:100236245-100236267 GAGGCTTTGTTTACATTGTGAGG + Intergenic
1195013167 X:100752860-100752882 GATGCTTTTCTTACACTGTTTGG - Intergenic
1195102317 X:101567220-101567242 GCGGCTTTGTATACACTGTGAGG - Intergenic
1195344941 X:103940438-103940460 GAGGCTTTGTTTACACTGTGAGG + Intronic
1195351166 X:103998156-103998178 GCGGCTTTGTTTACACTGTGAGG + Intergenic
1195434679 X:104828910-104828932 GCGGCTTTGTTTACCCTGTTAGG + Intronic
1195519233 X:105812229-105812251 TTGGCTTTGTTTACACTGTGAGG + Intergenic
1195580272 X:106493603-106493625 GCGGTTTTGTTTACTCTGTGAGG + Intergenic
1195720012 X:107858059-107858081 GCAGCTTTGTTTACTTTCTGAGG - Intronic
1195774810 X:108391467-108391489 GTGGCTTTGTTTACACTGTGAGG + Intronic
1195832742 X:109077680-109077702 GTGACTTTGTTTACACTCTGAGG + Intergenic
1195833718 X:109089041-109089063 GTGGCTTTGTCTACACTGTGAGG + Intergenic
1195842765 X:109192368-109192390 GGTGGCTTTTTTACACTGTGAGG - Intergenic
1195948200 X:110238406-110238428 GCGGCTTTGTTTACACTGTGAGG - Intronic
1195985586 X:110626675-110626697 GTGGCTTTGTGTACACTGTGAGG - Intergenic
1196133411 X:112181539-112181561 GAGGCTTTGTTTACACTGTGAGG - Intergenic
1196269792 X:113697692-113697714 GCAGCTTTCTTTACACTGTGAGG + Intergenic
1196273150 X:113735782-113735804 CCCCCTTTGTTTACACTGTGAGG + Intergenic
1196281164 X:113825297-113825319 AGGGCTTTGTTTACACTATGAGG + Intergenic
1196312393 X:114183841-114183863 GTGGCTTTGTTTACACTGTGAGG - Intergenic
1196367798 X:114942994-114943016 GTGGCTTTGTTTATACTGTGAGG + Intergenic
1196545711 X:116962358-116962380 GCTGCTTTGTTTACACTGTGAGG + Intergenic
1196571291 X:117268707-117268729 GTGGCTTTGTTTACACTGTGAGG - Intergenic
1196602933 X:117622868-117622890 GAAGCTTTATTTACACTGTGAGG + Intergenic
1196946579 X:120832843-120832865 GCGGCTTTGTTTACACTGTGCGG + Intergenic
1196960203 X:120992833-120992855 GCAGCTTTGTTTACACTGTGAGG + Intergenic
1197142209 X:123130003-123130025 GCGACTTTGTTTACACTGTGAGG - Intergenic
1197157238 X:123283604-123283626 GTGGCTTTGTTTACACTGTGAGG - Intronic
1197191108 X:123648673-123648695 GCAGCTTTGTTTACACTGTGAGG - Intronic
1197350118 X:125372531-125372553 GTGGTTTTGTTTACACTGTGAGG + Intergenic
1197614291 X:128674805-128674827 GTGGCTCTGTTTACACTGTGAGG + Intergenic
1197780121 X:130151032-130151054 CCTGTTTTGTTGACCCTGTGGGG - Intronic
1197847060 X:130814102-130814124 GTGGCTTTGTTTACAGTGTGAGG - Intronic
1197880742 X:131164192-131164214 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1197906264 X:131428623-131428645 TTGGCTTTTTTTACACTGTGAGG - Intergenic
1198002260 X:132451451-132451473 GTGGCTTTGTTTACGCTGTGGGG + Intronic
1198085637 X:133279290-133279312 GAGGCTTTGTTTACACTGTGAGG - Intergenic
1198140899 X:133802416-133802438 ACTGTTTTGTATAAACTGTGTGG + Intronic
1198295377 X:135282272-135282294 GTGGCTTTGTTTATACTGTGAGG + Intronic
1198519009 X:137433739-137433761 GTAGCTTTGTTTACGCTGTGAGG - Intergenic
1198555830 X:137792393-137792415 GTGGCTTTGTTTGCACTGTGAGG - Intergenic
1198678767 X:139158469-139158491 GCAGCTTTCTTTACACTGTGAGG - Intronic
1199012168 X:142770556-142770578 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1199094484 X:143723834-143723856 GCAGCTTTGTTGACACTGTGAGG - Intergenic
1199436616 X:147819733-147819755 GGGGCTTTGTTTACACTGTGAGG - Intergenic
1199469804 X:148181823-148181845 GCAGCTTTGTTTACACTGTGAGG + Intergenic
1199477349 X:148260184-148260206 GTGGCTTTGTTTACACTGTGAGG + Intergenic
1200333237 X:155319918-155319940 GTGGCTTTGTTTACACTGTGAGG - Intronic
1200388481 X:155918089-155918111 GCCACTCTGTTTACACAGTGAGG + Intronic
1200504871 Y:3999750-3999772 GCAGCTTTGTTTACACTGTGAGG - Intergenic
1200549361 Y:4559106-4559128 GCGGCTTTGGTTACATTGTGAGG - Intergenic
1200549397 Y:4559328-4559350 GAGGCTTTGCTTACACTGTGAGG - Intergenic
1200664142 Y:5999312-5999334 GTGGCTTTGTTTACACTGTGAGG - Intergenic
1200732572 Y:6758416-6758438 GCTGCTTTGTTTACACTGTGAGG + Intergenic
1201290282 Y:12415918-12415940 GCTGCTGTTGCTACACTGTGAGG - Intergenic
1201312832 Y:12612383-12612405 GCAGCTTCCTTAACACTGTGAGG - Intergenic
1201371462 Y:13269288-13269310 GAGGCTTTGTTTACGCTGTGAGG + Intronic
1201394750 Y:13536613-13536635 GTGACTTTGTTTACACTGTGAGG + Intergenic
1201406149 Y:13652325-13652347 ACAGCTTTGTTTATACTGTGAGG + Intergenic
1201462278 Y:14239656-14239678 GTGGCTTTGTTTATACTGTGAGG - Intergenic
1201511560 Y:14769908-14769930 GAGGCTTTGTTTACACTGTGAGG - Intronic
1201519631 Y:14859345-14859367 GAGGCTTTGTTTACACTGTGAGG - Intergenic
1201543209 Y:15131883-15131905 GTAGCTTTGTTTACCCTGTGAGG - Intergenic
1201563583 Y:15343646-15343668 GTGGCTTTGTTTACATTGTGAGG + Intergenic
1201689987 Y:16752798-16752820 TCAGCTTTGTTTACACTGTGAGG + Intergenic
1201705114 Y:16928357-16928379 GCGGCTCTGTATACACTGTGGGG - Intergenic
1201707155 Y:16949952-16949974 GCAGCTTTGTTTACATTGTGAGG - Intergenic
1201848537 Y:18450999-18451021 GAGGCTTTGTTTACACCATGAGG + Intergenic
1201854071 Y:18521356-18521378 GCAGCTTTCTTAACACTGTGAGG - Intergenic
1201879250 Y:18799028-18799050 GCAGCTTTCTTAACACTGTGAGG + Intronic
1201884780 Y:18869376-18869398 GAGGCTTTGTTTACACCATGAGG - Intergenic
1201961913 Y:19690262-19690284 ATGGCTTTGTTTACACTGTGAGG + Intergenic
1201979341 Y:19890734-19890756 GCAACTGTGTTTACCCTGTGAGG + Intergenic
1202057293 Y:20848322-20848344 GCGGCTTTGTTTACACTGTGAGG + Intergenic
1202175595 Y:22096134-22096156 GTTGCTTTGTTTGTGCTGTGGGG - Intergenic
1202215766 Y:22490248-22490270 GTTGCTTTGTTTGTGCTGTGGGG + Intergenic
1202335194 Y:23801368-23801390 GCAGCTTTGTTTACACTATGAGG - Intergenic
1202535573 Y:25868691-25868713 GCAGCTTTGTTTACACTATGAGG + Intergenic