ID: 1196555290

View in Genome Browser
Species Human (GRCh38)
Location X:117078210-117078232
Sequence TGGATTATCAGGGACAGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196555282_1196555290 3 Left 1196555282 X:117078184-117078206 CCAAAACTGCTTTCTGTAGTTTC No data
Right 1196555290 X:117078210-117078232 TGGATTATCAGGGACAGAGGGGG No data
1196555281_1196555290 4 Left 1196555281 X:117078183-117078205 CCCAAAACTGCTTTCTGTAGTTT No data
Right 1196555290 X:117078210-117078232 TGGATTATCAGGGACAGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196555290 Original CRISPR TGGATTATCAGGGACAGAGG GGG Intergenic
No off target data available for this crispr