ID: 1196561616

View in Genome Browser
Species Human (GRCh38)
Location X:117155962-117155984
Sequence GCTGATAAGCAGCTTCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196561613_1196561616 -8 Left 1196561613 X:117155947-117155969 CCAAAATCTCCTAAAGCTGATAA 0: 44
1: 10139
2: 4985
3: 2804
4: 2080
Right 1196561616 X:117155962-117155984 GCTGATAAGCAGCTTCAGCAGGG No data
1196561609_1196561616 7 Left 1196561609 X:117155932-117155954 CCCCATTGTCTCAGCCCAAAATC 0: 4647
1: 5120
2: 4026
3: 2683
4: 1898
Right 1196561616 X:117155962-117155984 GCTGATAAGCAGCTTCAGCAGGG No data
1196561610_1196561616 6 Left 1196561610 X:117155933-117155955 CCCATTGTCTCAGCCCAAAATCT 0: 4768
1: 5256
2: 4214
3: 2781
4: 1895
Right 1196561616 X:117155962-117155984 GCTGATAAGCAGCTTCAGCAGGG No data
1196561612_1196561616 -7 Left 1196561612 X:117155946-117155968 CCCAAAATCTCCTAAAGCTGATA 0: 48
1: 10182
2: 4578
3: 2989
4: 3300
Right 1196561616 X:117155962-117155984 GCTGATAAGCAGCTTCAGCAGGG No data
1196561608_1196561616 20 Left 1196561608 X:117155919-117155941 CCTATTTAGAAAACCCCATTGTC No data
Right 1196561616 X:117155962-117155984 GCTGATAAGCAGCTTCAGCAGGG No data
1196561611_1196561616 5 Left 1196561611 X:117155934-117155956 CCATTGTCTCAGCCCAAAATCTC 0: 4772
1: 5228
2: 4198
3: 2662
4: 2074
Right 1196561616 X:117155962-117155984 GCTGATAAGCAGCTTCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196561616 Original CRISPR GCTGATAAGCAGCTTCAGCA GGG Intergenic
No off target data available for this crispr