ID: 1196566796

View in Genome Browser
Species Human (GRCh38)
Location X:117216353-117216375
Sequence CTGAGCAAAAATAATAAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196566793_1196566796 6 Left 1196566793 X:117216324-117216346 CCACTTCAGACTGAGTAGCCATA No data
Right 1196566796 X:117216353-117216375 CTGAGCAAAAATAATAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196566796 Original CRISPR CTGAGCAAAAATAATAAAGT TGG Intergenic
No off target data available for this crispr