ID: 1196570479

View in Genome Browser
Species Human (GRCh38)
Location X:117260976-117260998
Sequence GCGCCGTTTTTTAAGCTGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196570479_1196570490 26 Left 1196570479 X:117260976-117260998 CCGACCAGCTTAAAAAACGGCGC No data
Right 1196570490 X:117261025-117261047 CTCGGAGGGTCCTACGCCCACGG 0: 903
1: 1508
2: 1213
3: 891
4: 695
1196570479_1196570482 3 Left 1196570479 X:117260976-117260998 CCGACCAGCTTAAAAAACGGCGC No data
Right 1196570482 X:117261002-117261024 ACCAGATTATATCCCGCACCTGG 0: 24
1: 410
2: 1003
3: 2049
4: 1454
1196570479_1196570486 12 Left 1196570479 X:117260976-117260998 CCGACCAGCTTAAAAAACGGCGC No data
Right 1196570486 X:117261011-117261033 TATCCCGCACCTGGCTCGGAGGG 0: 496
1: 1490
2: 1803
3: 1148
4: 796
1196570479_1196570484 8 Left 1196570479 X:117260976-117260998 CCGACCAGCTTAAAAAACGGCGC No data
Right 1196570484 X:117261007-117261029 ATTATATCCCGCACCTGGCTCGG 0: 636
1: 1265
2: 1149
3: 581
4: 360
1196570479_1196570485 11 Left 1196570479 X:117260976-117260998 CCGACCAGCTTAAAAAACGGCGC No data
Right 1196570485 X:117261010-117261032 ATATCCCGCACCTGGCTCGGAGG 0: 494
1: 1487
2: 1828
3: 1188
4: 779

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196570479 Original CRISPR GCGCCGTTTTTTAAGCTGGT CGG (reversed) Intergenic
No off target data available for this crispr