ID: 1196577125

View in Genome Browser
Species Human (GRCh38)
Location X:117332241-117332263
Sequence CTGCATTCAAGTATCTATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196577125_1196577131 21 Left 1196577125 X:117332241-117332263 CCCACATAGATACTTGAATGCAG No data
Right 1196577131 X:117332285-117332307 AAGTAAAAAAGATTTTAAAAGGG No data
1196577125_1196577132 22 Left 1196577125 X:117332241-117332263 CCCACATAGATACTTGAATGCAG No data
Right 1196577132 X:117332286-117332308 AGTAAAAAAGATTTTAAAAGGGG No data
1196577125_1196577127 -7 Left 1196577125 X:117332241-117332263 CCCACATAGATACTTGAATGCAG No data
Right 1196577127 X:117332257-117332279 AATGCAGCCTCAAGACCAACAGG No data
1196577125_1196577130 20 Left 1196577125 X:117332241-117332263 CCCACATAGATACTTGAATGCAG No data
Right 1196577130 X:117332284-117332306 AAAGTAAAAAAGATTTTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196577125 Original CRISPR CTGCATTCAAGTATCTATGT GGG (reversed) Intergenic
No off target data available for this crispr