ID: 1196577854

View in Genome Browser
Species Human (GRCh38)
Location X:117341184-117341206
Sequence TGCAATAAACATAAAGGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196577854_1196577856 4 Left 1196577854 X:117341184-117341206 CCTACACCTTTATGTTTATTGCA No data
Right 1196577856 X:117341211-117341233 TATTCACAATAGCAAAGATATGG 0: 481
1: 5486
2: 28466
3: 17467
4: 10872

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196577854 Original CRISPR TGCAATAAACATAAAGGTGT AGG (reversed) Intergenic
No off target data available for this crispr