ID: 1196596242

View in Genome Browser
Species Human (GRCh38)
Location X:117548886-117548908
Sequence CAAGTTCACCAGTTCCCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196596242_1196596244 13 Left 1196596242 X:117548886-117548908 CCCATGGGGAACTGGTGAACTTG No data
Right 1196596244 X:117548922-117548944 TAAATGAACAATGTCCATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196596242 Original CRISPR CAAGTTCACCAGTTCCCCAT GGG (reversed) Intergenic
No off target data available for this crispr