ID: 1196600142

View in Genome Browser
Species Human (GRCh38)
Location X:117592050-117592072
Sequence CAATATTAGATCATTGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196600141_1196600142 15 Left 1196600141 X:117592012-117592034 CCACACAATAATAGTGGGAGACT 0: 1257
1: 5149
2: 5372
3: 1946
4: 1256
Right 1196600142 X:117592050-117592072 CAATATTAGATCATTGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196600142 Original CRISPR CAATATTAGATCATTGAGAC AGG Intergenic
No off target data available for this crispr