ID: 1196607639

View in Genome Browser
Species Human (GRCh38)
Location X:117674202-117674224
Sequence TGTTGTAGCACAGGAGAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196607637_1196607639 -9 Left 1196607637 X:117674188-117674210 CCTGGGAAAATTATTGTTGTAGC No data
Right 1196607639 X:117674202-117674224 TGTTGTAGCACAGGAGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196607639 Original CRISPR TGTTGTAGCACAGGAGAGAC TGG Intergenic
No off target data available for this crispr