ID: 1196608307

View in Genome Browser
Species Human (GRCh38)
Location X:117681301-117681323
Sequence TGATTAACTTTGGAGAAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196608307_1196608311 21 Left 1196608307 X:117681301-117681323 CCCACCTTCTCCAAAGTTAATCA No data
Right 1196608311 X:117681345-117681367 TATGTGATAGCACATCTATCTGG No data
1196608307_1196608312 22 Left 1196608307 X:117681301-117681323 CCCACCTTCTCCAAAGTTAATCA No data
Right 1196608312 X:117681346-117681368 ATGTGATAGCACATCTATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196608307 Original CRISPR TGATTAACTTTGGAGAAGGT GGG (reversed) Intergenic
No off target data available for this crispr