ID: 1196608308

View in Genome Browser
Species Human (GRCh38)
Location X:117681302-117681324
Sequence ATGATTAACTTTGGAGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196608308_1196608312 21 Left 1196608308 X:117681302-117681324 CCACCTTCTCCAAAGTTAATCAT No data
Right 1196608312 X:117681346-117681368 ATGTGATAGCACATCTATCTGGG No data
1196608308_1196608311 20 Left 1196608308 X:117681302-117681324 CCACCTTCTCCAAAGTTAATCAT No data
Right 1196608311 X:117681345-117681367 TATGTGATAGCACATCTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196608308 Original CRISPR ATGATTAACTTTGGAGAAGG TGG (reversed) Intergenic
No off target data available for this crispr