ID: 1196608309 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:117681305-117681327 |
Sequence | ATCATGATTAACTTTGGAGA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1196608309_1196608312 | 18 | Left | 1196608309 | X:117681305-117681327 | CCTTCTCCAAAGTTAATCATGAT | No data | ||
Right | 1196608312 | X:117681346-117681368 | ATGTGATAGCACATCTATCTGGG | No data | ||||
1196608309_1196608311 | 17 | Left | 1196608309 | X:117681305-117681327 | CCTTCTCCAAAGTTAATCATGAT | No data | ||
Right | 1196608311 | X:117681345-117681367 | TATGTGATAGCACATCTATCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1196608309 | Original CRISPR | ATCATGATTAACTTTGGAGA AGG (reversed) | Intergenic | ||
No off target data available for this crispr |