ID: 1196608312

View in Genome Browser
Species Human (GRCh38)
Location X:117681346-117681368
Sequence ATGTGATAGCACATCTATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196608308_1196608312 21 Left 1196608308 X:117681302-117681324 CCACCTTCTCCAAAGTTAATCAT No data
Right 1196608312 X:117681346-117681368 ATGTGATAGCACATCTATCTGGG No data
1196608307_1196608312 22 Left 1196608307 X:117681301-117681323 CCCACCTTCTCCAAAGTTAATCA No data
Right 1196608312 X:117681346-117681368 ATGTGATAGCACATCTATCTGGG No data
1196608309_1196608312 18 Left 1196608309 X:117681305-117681327 CCTTCTCCAAAGTTAATCATGAT No data
Right 1196608312 X:117681346-117681368 ATGTGATAGCACATCTATCTGGG No data
1196608310_1196608312 12 Left 1196608310 X:117681311-117681333 CCAAAGTTAATCATGATATTAAT No data
Right 1196608312 X:117681346-117681368 ATGTGATAGCACATCTATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196608312 Original CRISPR ATGTGATAGCACATCTATCT GGG Intergenic
No off target data available for this crispr